Volume 13, Number 7—July 2007
Dispatch
Virus Detection and Monitoring of Viral Load in Crimean-Congo Hemorrhagic Fever Virus Patients
Roman Wölfel*†, Janusz T. Paweska‡, Nadine Petersen†, Antoinette A. Grobbelaar‡, Patricia A. Leman‡, Roger Hewson§, Marie-Claude Georges-Courbot¶, Anna Papa#, Stephan Günther†, and Sung Sup Park†
Table
Protocol for real-time reverse transcription–PCR
| Oligonucleotide* | Purpose, concentration in nM | Sequence and label (5′→3′) | Position (U88410)† |
|---|---|---|---|
| RWCF | Forward primer, 600 | CAAGGGGTACCAAGAAAATGAAGAAGGC | 1068–1095 |
| RWCR | Reverse primer, 600 | GCCACAGGGATTGTTCCAAAGCAGAC | 1248–1223 |
| SE01 | Broad-range probe, 100 | FAM-ATCTACATGCACCCTGCTGTGTTGACA-TAMRA | 1172–1198 |
| SE03 | Additional probe, 100 | FAM-ATTTACATGCACCCTGCCGTGCTTACA-TAMRA | 1172–1198 |
| SE0A | Additional probe, 100 | FAM-AGCTTCTTCCCCCACTTCATTGGAGT -TAMRA | 1131–1106 |
*All oligonucleotides were used in an assay with the following protocol: 25-µL reaction volume, 5-µL plasma RNA (QIAamp Viral RNA mini kit; QIAGEN, Valencia, CA, USA), 1× concentration of buffer and enzymes from the OneStep RT-PCR kit (QIAGEN), and 400 µmol dNTP, 800-ng nonacetylated bovine serum albumin (Sigma-Aldrich, Munich, Germany). The cycling parameters followed in a Roche LightCycler 1.2 (Roche, Penzberg, Germany) were as follows: 30 min at 50°C, 15 min at 95°C, 46× 15 s at 94°C, and 30 s at 59°C. Fluorescence acquisition occurred at the 59°C step, wavelength filter F1/F2 mode.
†GenBank accession number.
Page created: June 21, 2010
Page updated: June 21, 2010
Page reviewed: June 21, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
Content Credential