Volume 14, Number 11—November 2008
Letter
Paralysis Case and Contact Spread of Recombinant Vaccine–derived Poliovirus, Spain
Table
Laboratory methods used for study of vaccine-derived poliovirus case, Spain, 2005*
procedure | Test | Method† | Sample |
---|---|---|---|
Sample preparation |
Concentration of sewage for detection of enterovirus in the environment | Concentration with negative charge filters (Millipore, Billerica, MA, USA; 0.45 μm) of 20 L of local sewage | E |
RNA purification from samples (before molecular analysis) |
MagAttract Virus Mini-Biorobot (QIAGEN GmbH, Hilden, Germany) from 200 μL of stool sample dissolved in water |
S |
|
Classic virology techniques |
Cellular culture (Biosafety Level 3) for growing PV | LB20 (transgenic mouse), RD (human rhabdomyosarcoma), HEF (human fibroblast), A-549 (ATCC-CCL185) | S, E |
Immunofluorescence of infected cells | Lim-Beyesh-Melnick A-H and RIVM A-G pools | I | |
EV neutralization assay |
Antibodies (Chemicon, Temecula, CA, USA) |
I |
|
Molecular techniques | Molecular EV detection | RT-nested PCR 5′ UTR (4) | S, I, E |
Molecular EV quantification | MutaReal EV real-time PCR kit (Immunodiagnostik AG, Bensheim, Germany) | S | |
Molecular EV typing | RT-nested PCR in major VP1 region (5) | S, I, E | |
PV intratypic characterization | Specific vaccine PV RT-PCR (6) | S, I, E | |
PV genome sequencing fragment 1 | 1s: TAAAACAGCTCTGGGGTTGTA (2–22) 1as: CACCACCCAAGAAGCGGCC (1023–1041) 1ns: GCTCTGGGGTTGTACCCACTCC (9–30) 1nas:TAACTCTGGGCAATTCAACGA(1001–1021) | S, I | |
PV genome sequencing fragment 2† | 2s: CATGCTAAACTCCCCAAAC (945–963) 2as: AGGTGCGCAACATGATGG (1882–1910) | S, I | |
PV genome sequencing fragment 3† | 3s: CAGACAATTACCAGTCTCC (1814–1832) 3as: ATTACTAAAAATGCATTGGTTCCC (2518–2541) | S, I | |
PV genome sequencing VP1 fragment† | VP1s: ACAACACACATTAGTCAAGAGGCTA (2449–2473) VP1as: GGATTTGGACACCAAAACAAAGC (3385–3407) | S, I | |
PV genome sequencing fragment 4† | 4s:GTGCCCACGACCTCCA (3288–3303) 4as: CTTGGGTGCGACATCTCA (4042–4059) | S, I | |
PV genome sequencing fragment 5† | 5s: TAATCAAAATTATCTCATCACTTGTG (3962–3987) 5as: CATGAGCGAGTACTCCAGA (4872–4889) | S, I | |
PV genome sequencing fragment 6† | 6s: CTGGCCAGGAGATTCG (4834–4949) 6as: AAATGATGGAGTTTTGATCGT(5725–5747) | S, I | |
PV genome sequencing fragment 7† | 7s: AGGCAGGAACTAATCTTGAAA (5630–5650) 7as: CTAAGTATGTAGGCAACAAGAT (6164–6185) | S, I | |
PV genome sequencing fragment 8† | 8s: CAAAAATGATCCCAGGCTCA (6117–6136) 8as: AAACCTACAAGGGCATAGATT (6917–6937) | S, I | |
PV genome sequencing fragment 9† | 9s: CAGGCACATCAATTTTTAACTC (6857–6878) 9as: GGTAAATTTTTCTTTAATTCGGGG(7416–7439) | S, I | |
Additional PV sequencing primers | 447as: CCGGCCCCTGAATGCGGC (447–464) 4666s: CCAGACGGAGCAGACATG (4666–4683) | S, I |
*E, local sewage; S, stools; I, isolates; EV, enterovirus; PV, poliovirus; UTR, untranslated region; VP1, virus capsid protein.
†Sense (s) and antisense (as) primers: 5′ → 3' sequence (position according to X00595). n, nested. All reverse transcription–PCR (RT-PCR) systems had the same conditions: 5 μL of clinical samples (case) or isolates (contacts) were added to the reaction mixture (final volume 50 μL): AMV/Tfl 1X reaction buffer, 2 mmol/L MgSO4, 200 μM each dNTP, 1 μM each primer, 5 U of AMV RT, and 5 U of Tfl DNA polymerase (Access RT-PCR System, Promega, Madison, WI, USA). First RT step of 45 min at 48°C, 2 min at 94°C, 45 cycles of denaturation (94°C, 2 min), annealing (53°C, 1 min), and elongation (68°C,1 min 30 s).
References
- Dowdle W, Kew O. Vaccine-derived polioviruses: is it time to stop using the word “rare”? J Infect Dis. 2006;194:539–41. DOIPubMedGoogle Scholar
- Kew OM, Sutter RW, de Gourville EM, Dowdle WR, Pallansch MA. Vaccine-derived polioviruses and the endgame strategy for global polio eradication. Annu Rev Microbiol. 2005;59:587–635. DOIPubMedGoogle Scholar
- Trallero G, Avellon A, Otero A, de Miguel T, Alonso M, Perez-Brena P. Laboratory Network within the Polio Eradication Initiative (1998–2003): six years of surveillance for acute flaccid paralysis in Spain [in Spanish]. Enferm Infecc Microbiol Clin. 2006;24:167–72. DOIPubMedGoogle Scholar
- Cherkasova EA, Yakovenko ML, Rezapkin GV, Korotkova EA, Ivanova OE, Eremeeva TP, Spread of vaccine-derived poliovirus from a paralytic case in an immunodeficient child: an insight into the natural evolution of oral polio vaccine. J Virol. 2005;79:1062–70. DOIPubMedGoogle Scholar
- Karakasiliotis I, Paximadi E, Markoulatos P. Evolution of a rare vaccine-derived multirecombinant poliovirus. J Gen Virol. 2005;86:3137–42. DOIPubMedGoogle Scholar
- Korotkova EA, Park R, Cherkasova EA, Lipskaya GY, Chumakov KM, Feldman EV, Retrospective analysis of a local cessation of vaccination against poliomyelitis: a possible scenario for the future. J Virol. 2003;77:12460–5. DOIPubMedGoogle Scholar
- Parvaneh N, Shahmahmoudi S, Tabatabai H, Zahraei M, Mousavi T, Esteghamati AR, Vaccine-associated paralytic poliomyelitis in a patient with MHC class II deficiency. J Clin Virol. 2007;39:145–8. DOIPubMedGoogle Scholar