Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 14, Number 11—November 2008

Letter

Paralysis Case and Contact Spread of Recombinant Vaccine–derived Poliovirus, Spain

Ana Avellón1, Maria Cabrerizo1, Teresa de Miguel, Pilar Pérez-Breña, Antonio Tenorio, Jose Luis Pérez, Maria Victoria Martínez de Aragón, and Gloria Trallero
Author affiliations: 1These authors contributed equally to this article.; Instituto de Salud Carlos III National Centre of Microbiology, Madrid, Spain (A. Avellón, M. Cabrerizo, T. de Miguel, P. Pérez-Breña, A. Tenorio, G. Trallero); Instituto de Salud Carlos III National Centre of Epidemiology, Madrid (M.V. Martínez de Aragón); Son Dureta Hospital, Palma de Mallorca, Spain (J.L. Pérez);

Main Article

Table

Laboratory methods used for study of vaccine-derived poliovirus case, Spain, 2005*

procedure Test Method† Sample
Sample preparation
Concentration of sewage for detection of enterovirus in the environment Concentration with negative charge filters (Millipore, Billerica, MA, USA; 0.45 μm) of 20 L of local sewage E
RNA purification from samples (before molecular analysis)
MagAttract Virus Mini-Biorobot (QIAGEN GmbH, Hilden, Germany) from 200 μL of stool sample dissolved in water
S
Classic virology techniques
Cellular culture (Biosafety Level 3) for growing PV LB20 (transgenic mouse), RD (human rhabdomyosarcoma), HEF (human fibroblast), A-549 (ATCC-CCL185) S, E
Immunofluorescence of infected cells Lim-Beyesh-Melnick A-H and RIVM A-G pools I
EV neutralization assay
Antibodies (Chemicon, Temecula, CA, USA)
I
Molecular techniques Molecular EV detection RT-nested PCR 5′ UTR (4) S, I, E
Molecular EV quantification MutaReal EV real-time PCR kit (Immunodiagnostik AG, Bensheim, Germany) S
Molecular EV typing RT-nested PCR in major VP1 region (5) S, I, E
PV intratypic characterization Specific vaccine PV RT-PCR (6) S, I, E
PV genome sequencing fragment 1 1s: TAAAACAGCTCTGGGGTTGTA (2–22)
1as: CACCACCCAAGAAGCGGCC (1023–1041)
1ns: GCTCTGGGGTTGTACCCACTCC (9–30)
1nas:TAACTCTGGGCAATTCAACGA(1001–1021) S, I
PV genome sequencing fragment 2† 2s: CATGCTAAACTCCCCAAAC (945–963)
2as: AGGTGCGCAACATGATGG (1882–1910) S, I
PV genome sequencing fragment 3† 3s: CAGACAATTACCAGTCTCC (1814–1832)
3as: ATTACTAAAAATGCATTGGTTCCC (2518–2541) S, I
PV genome sequencing VP1 fragment† VP1s: ACAACACACATTAGTCAAGAGGCTA (2449–2473)
VP1as: GGATTTGGACACCAAAACAAAGC (3385–3407) S, I
PV genome sequencing fragment 4† 4s:GTGCCCACGACCTCCA (3288–3303)
4as: CTTGGGTGCGACATCTCA (4042–4059) S, I
PV genome sequencing fragment 5† 5s: TAATCAAAATTATCTCATCACTTGTG (3962–3987)
5as: CATGAGCGAGTACTCCAGA (4872–4889) S, I
PV genome sequencing fragment 6† 6s: CTGGCCAGGAGATTCG (4834–4949)
6as: AAATGATGGAGTTTTGATCGT(5725–5747) S, I
PV genome sequencing fragment 7† 7s: AGGCAGGAACTAATCTTGAAA (5630–5650)
7as: CTAAGTATGTAGGCAACAAGAT (6164–6185) S, I
PV genome sequencing fragment 8† 8s: CAAAAATGATCCCAGGCTCA (6117–6136)
8as: AAACCTACAAGGGCATAGATT (6917–6937) S, I
PV genome sequencing fragment 9† 9s: CAGGCACATCAATTTTTAACTC (6857–6878)
9as: GGTAAATTTTTCTTTAATTCGGGG(7416–7439) S, I
Additional PV sequencing primers 447as: CCGGCCCCTGAATGCGGC (447–464)
4666s: CCAGACGGAGCAGACATG (4666–4683) S, I

*E, local sewage; S, stools; I, isolates; EV, enterovirus; PV, poliovirus; UTR, untranslated region; VP1, virus capsid protein.
†Sense (s) and antisense (as) primers: 5′ → 3' sequence (position according to X00595). n, nested. All reverse transcription–PCR (RT-PCR) systems had the same conditions: 5 μL of clinical samples (case) or isolates (contacts) were added to the reaction mixture (final volume 50 μL): AMV/Tfl 1X reaction buffer, 2 mmol/L MgSO4, 200 μM each dNTP, 1 μM each primer, 5 U of AMV RT, and 5 U of Tfl DNA polymerase (Access RT-PCR System, Promega, Madison, WI, USA). First RT step of 45 min at 48°C, 2 min at 94°C, 45 cycles of denaturation (94°C, 2 min), annealing (53°C, 1 min), and elongation (68°C,1 min 30 s).

Main Article

References
  1. Dowdle  W, Kew  O. Vaccine-derived polioviruses: is it time to stop using the word “rare”? J Infect Dis. 2006;194:539–41. DOIPubMedGoogle Scholar
  2. Kew  OM, Sutter  RW, de Gourville  EM, Dowdle  WR, Pallansch  MA. Vaccine-derived polioviruses and the endgame strategy for global polio eradication. Annu Rev Microbiol. 2005;59:587–635. DOIPubMedGoogle Scholar
  3. Trallero  G, Avellon  A, Otero  A, de Miguel  T, Alonso  M, Perez-Brena  P. Laboratory Network within the Polio Eradication Initiative (1998–2003): six years of surveillance for acute flaccid paralysis in Spain [in Spanish]. Enferm Infecc Microbiol Clin. 2006;24:167–72. DOIPubMedGoogle Scholar
  4. Casas  I, Palacios  GF, Trallero  G, Cisterna  D, Freire  MC, Tenorio  A. Molecular characterization of human enteroviruses in clinical samples: comparison between VP2, VP1, and RNA polymerase regions using RT nested PCR assays and direct sequencing of products. J Med Virol. 2001;65:138–48. DOIPubMedGoogle Scholar
  5. Casas  I, Tenorio  A, Echevarria  JM, Klapper  PE, Cleator  GM. Detection of enteroviral RNA and specific DNA of herpesviruses by multiplex genome amplification. J Virol Methods. 1997;66:39–50. DOIPubMedGoogle Scholar
  6. Yang  CF, De  L, Holloway  BP, Pallansch  MA, Kew  OM. Detection and identification of vaccine-related polioviruses by the polymerase chain reaction. Virus Res. 1991;20:159–79. DOIPubMedGoogle Scholar
  7. Cherkasova  EA, Yakovenko  ML, Rezapkin  GV, Korotkova  EA, Ivanova  OE, Eremeeva  TP, Spread of vaccine-derived poliovirus from a paralytic case in an immunodeficient child: an insight into the natural evolution of oral polio vaccine. J Virol. 2005;79:1062–70. DOIPubMedGoogle Scholar
  8. Karakasiliotis  I, Paximadi  E, Markoulatos  P. Evolution of a rare vaccine-derived multirecombinant poliovirus. J Gen Virol. 2005;86:3137–42. DOIPubMedGoogle Scholar
  9. Korotkova  EA, Park  R, Cherkasova  EA, Lipskaya  GY, Chumakov  KM, Feldman  EV, Retrospective analysis of a local cessation of vaccination against poliomyelitis: a possible scenario for the future. J Virol. 2003;77:12460–5. DOIPubMedGoogle Scholar
  10. Parvaneh  N, Shahmahmoudi  S, Tabatabai  H, Zahraei  M, Mousavi  T, Esteghamati  AR, Vaccine-associated paralytic poliomyelitis in a patient with MHC class II deficiency. J Clin Virol. 2007;39:145–8. DOIPubMedGoogle Scholar

Main Article

1These authors contributed equally to this article.

Page created: July 18, 2010
Page updated: July 18, 2010
Page reviewed: July 18, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external