Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 14, Number 3—March 2008

Research

Discovering and Differentiating New and Emerging Clonal Populations of Chlamydia trachomatis with a Novel Shotgun Cell Culture Harvest Assay

Naraporn Somboonna*†, Sally Mead*, Jessica Liu†, and Deborah Dean*†‡Comments to Author 
Author affiliations: *Children’s Hospital Oakland Research Institute, Oakland, California, USA; †University of California, Berkeley, California, USA; ‡University of California School of Medicine, San Francisco, California, USA;

Main Article

Table 2

PCR and sequencing primers used for determining strain types of clonal isolates from reference strains and clinical samples

Primer Sequence (5′ → 3′) Location Ref
CTompA-F GTCCCGCCAGAAAAAGATAG –60 to –41 This study
CTompA-seqF ATAGCGAGCACAAAGAGAGC –44 to –25 This study
VB3 CATCGTAGTCAATAGAGGCAT 817 to 797 (22)
MVF3 TGTAAAACGACGGCCAGTGCCCGTGCAGCTTT 561 to 611 (22)
CTompA-B ACGGATAGTGTTATTAACAAAGAT 1261 to 1225 This study
CTompA-seqB GTAAAACGACGGCCAGT 562 to 596 This study
C16SrRNA-F CAGTCGAGAATCTTTCGCAAT 359 to 380 This study
C16SrRNA-seqF AAGGCTCTAGGGTTGTAAAGCACTTT 419 to 444 This study
C16SrRNA-B TACTGGCCATTGTAGCACGTGTGT 1230 to 1253 This study
Plasmid-PF5 AGACTTGGTCATAATGGACTT 1022 to 1002 This study
Plasmid-seqPF5 AGACTTGGTCATAATGGACTT 1022 to 1002 This study
Plasmid-PB5 TTGTCTCGGATTTTAAAAAATGT 588 to 566 This study
FCabortus GGTATGTTTAGGCATCTAAAA 172 to 192 This study
RCabortus2 GGCCATTGTAGCACGTGTGTA 1248 to 1228 This study

Main Article

References
  1. World Health Organization. Sexually transmitted diseases [cited 2007 Nov 29]. Available from http://www.who.int/vaccine_research/diseases/soa_std/en/print.html
  2. Moulder  JW. Interaction of chlamydiae and host cells in vitro. Microbiol Rev. 1991;55:143–90.PubMedGoogle Scholar
  3. Dean  D, Millman  K. Molecular and mutation trends analyses of omp1 alleles for serovar E of Chlamydia trachomatis. Implications for the immunopathogenesis of disease. J Clin Invest. 1997;99:475–83. DOIPubMedGoogle Scholar
  4. Wang  SP, Grayston  JT. Three new serovars of Chlamydia trachomatis: Da, Ia, and L2a. J Infect Dis. 1991;163:403–5.PubMedGoogle Scholar
  5. Dean  D, Oudens  E, Bolan  G, Padian  N, Schachter  J. Major outer membrane protein variants of Chlamydia trachomatis are associated with severe upper genital tract infections and histopathology in San Francisco. J Infect Dis. 1995;172:1013–22.PubMedGoogle Scholar
  6. Dean  D, Schachter  J, Dawson  CR, Stephens  RS. Comparison of the major outer membrane protein variant sequence regions of B/Ba isolates: a molecular epidemiologic approach to Chlamydia trachomatis infections. J Infect Dis. 1992;166:383–92.PubMedGoogle Scholar
  7. Hayes  LJ, Bailey  RL, Mabey  DC, Clarke  IN, Pickett  MA, Watt  PJ, Genotyping of Chlamydia trachomatis from a trachoma-endemic village in the Gambia by a nested polymerase chain reaction: identification of strain variants. J Infect Dis. 1992;166:1173–7.PubMedGoogle Scholar
  8. Millman  K, Black  CM, Johnson  RE, Stamm  WE, Jones  RB, Hook  EW, Population-based genetic and evolutionary analysis of Chlamydia trachomatis urogenital strain variation in the United States. J Bacteriol. 2004;186:2457–65. DOIPubMedGoogle Scholar
  9. Spaargaren  J, Fennema  HS, Morre  SA, de Vries  HJ, Coutinho  RA. New lymphogranuloma venereum Chlamydia trachomatis variant, Amsterdam. Emerg Infect Dis. 2005;11:1090–2.PubMedGoogle Scholar
  10. Pathela  P, Blank  S, Schillinger  JA. Lymphogranuloma venereum: old pathogen, new story. Curr Infect Dis Rep. 2007;9:143–50. DOIPubMedGoogle Scholar
  11. Dean  D, Suchland  R, Stamm  W. Evidence for long-term cervical persistence of Chlamydia trachomatis by omp1 genotyping. J Infect Dis. 2000;182:909–16. DOIPubMedGoogle Scholar
  12. Alzhanov  DT, Suchland  RJ, Bakke  AC, Stamm  WE, Rockey  DD. Clonal isolation of chlamydia-infected cells using flow cytometry. J Microbiol Methods. 2007;68:201–8. DOIPubMedGoogle Scholar
  13. Lin  JS, Donegan  SP, Heeren  TC, Greenberg  M, Flaherty  EE, Haivanis  R, Transmission of Chlamydia trachomatis and Neisseria gonorrhoeae among men with urethritis and their female sex partners. J Infect Dis. 1998;178:1707–12. DOIPubMedGoogle Scholar
  14. Stothard  DR. Use of a reverse dot blot procedure to identify the presence of multiple serovars in Chlamydia trachomatis urogenital infection. J Clin Microbiol. 2001;39:2655–9. DOIPubMedGoogle Scholar
  15. Banks  J, Eddie  B, Schachter  J, Meyer  KF. Plaque formation by chlamydia in L cells. Infect Immun. 1970;1:259–62.PubMedGoogle Scholar
  16. Matsumoto  A, Izutsu  H, Miyashita  N, Ohuchi  M. Plaque formation by and plaque cloning of Chlamydia trachomatis biovar trachoma. J Clin Microbiol. 1998;36:3013–9.PubMedGoogle Scholar
  17. Betts  MJ, Russell  RB. Amino acid properties and consequences of substitutions. In: Barnes MR, Gray IC, editors. Bioinformatics for geneticists. West Sussex (UK): John Wiley & Sons; 2003. p. 289–316.
  18. Dean  D, Powers  VC. Persistent Chlamydia trachomatis infections resist apoptotic stimuli. Infect Immun. 2001;69:2442–7. DOIPubMedGoogle Scholar
  19. Black  CM. Current methods of laboratory diagnosis of Chlamydia trachomatis infections. Clin Microbiol Rev. 1997;10:160–84.PubMedGoogle Scholar
  20. Gouriet  F, Fenollar  F, Patrice  JY, Drancourt  M, Raoult  D. Use of shell-vial cell culture assay for isolation of bacteria from clinical specimens: 13 years of experience. J Clin Microbiol. 2005;43:4993–5002. DOIPubMedGoogle Scholar
  21. Gomes  JP, Nunes  A, Bruno  WJ, Borrego  MJ, Florindo  C, Dean  D. Polymorphisms in the nine polymorphic membrane proteins of Chlamydia trachomatis across all serovars: evidence for serovar Da recombination and correlation with tissue tropism. J Bacteriol. 2006;188:275–86. DOIPubMedGoogle Scholar
  22. Millman  KL, Tavare  S, Dean  D. Recombination in the ompA gene but not the omcB gene of Chlamydia contributes to serovar-specific differences in tissue tropism, immune surveillance, and persistence of the organism. J Bacteriol. 2001;183:5997–6008. DOIPubMedGoogle Scholar
  23. Gomes  JP, Bruno  WJ, Nunes  A, Santos  N, Florindo  C, Borrego  MJ, Evolution of Chlamydia trachomatis diversity occurs by widespread interstrain recombination involving hotspots. Genome Res. 2006;17:50–60. DOIPubMedGoogle Scholar
  24. Gieffers  J, Belland  RJ, Whitmire  W, Ouellette  S, Crane  D, Maass  M, Isolation of Chlamydia pneumoniae clonal variants by a focus-forming assay. Infect Immun. 2002;70:5827–34. DOIPubMedGoogle Scholar
  25. Thomson  NR, Yeats  C, Bell  K, Holden  MT, Bentley  SD, Livingstone  M, The Chlamydophila abortus genome sequence reveals an array of variable proteins that contribute to interspecies variation. Genome Res. 2005;15:629–40. DOIPubMedGoogle Scholar
  26. Longbottom  D, Coulter  LJ. Animal chlamydioses and zoonotic implications. J Comp Pathol. 2003;128:217–44. DOIPubMedGoogle Scholar
  27. Dean  D, Kandel  RP, Adhikari  HK, Hessel  T. Multiple Chlamydiaceae species in trachoma: implications for disease pathogenesis and control. PLoS Med. In press.
  28. Hayes  LJ, Yearsley  P, Treharne  JD, Ballard  RA, Fehler  GH, Ward  ME. Evidence for naturally occurring recombination in the gene encoding the major outer membrane protein of lymphogranuloma venereum isolates of Chlamydia trachomatis. Infect Immun. 1994;62:5659–63.PubMedGoogle Scholar
  29. Morré  SA, Ossewaarde  JM, Lan  J, van Doornum  GJ, Walboomers  JM, MacLaren  DM, Serotyping and genotyping of genital Chlamydia trachomatis isolates reveal variants of serovars Ba, G, and J as confirmed by omp1 nucleotide sequence analysis. J Clin Microbiol. 1998;36:345–51.PubMedGoogle Scholar
  30. MacArthur  MW, Thornton  JM. Influence of proline residues on protein conformation. J Mol Biol. 1991;218:397–412. DOIPubMedGoogle Scholar
  31. Sankararamakrishnan  R, Vishveshwara  S. Characterization of proline-containing alpha-helix (helix F model of bacteriorhodopsin) by molecular dynamics studies. Proteins. 1993;15:26–41. DOIPubMedGoogle Scholar
  32. Wang  Y, Berg  EA, Feng  X, Shen  L, Smith  T, Costello  CE, Identification of surface-exposed components of MOMP of Chlamydia trachomatis serovar F. Protein Sci. 2006;15:122–34. DOIPubMedGoogle Scholar
  33. Millman  K, Black  CM, Stamm  WE, Jones  RB, Hook  EW III, Martin  DH, Population-based genetic epidemiologic analysis of Chlamydia trachomatis serotypes and lack of association between ompA polymorphisms and clinical phenotypes. Microbes Infect. 2006;8:604–11. DOIPubMedGoogle Scholar
  34. O’Connell  CM, Nicks  KM. A plasmid-cured Chlamydia muridarum strain displays altered plaque morphology and reduced infectivity in cell culture. Microbiology. 2006;152:1601–7. DOIPubMedGoogle Scholar
  35. Comanducci  M, Ricci  S, Cevenini  R, Ratti  G. Diversity of the Chlamydia trachomatis common plasmid in biovars with different pathogenicity. Plasmid. 1990;23:149–54. DOIPubMedGoogle Scholar
  36. Thomas  NS, Lusher  M, Storey  CC, Clarke  IN. Plasmid diversity in Chlamydia. Microbiology. 1997;143:1847–54.PubMedGoogle Scholar
  37. Pickett  MA, Everson  JS, Pead  PJ, Clarke  IN. The plasmids of Chlamydia trachomatis and Chlamydophila pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmid-curing agents. Microbiology. 2005;151:893–903. DOIPubMedGoogle Scholar
  38. Beatty  WL. Lysosome repair enables host cell survival and bacterial persistence following Chlamydia trachomatis infection. Cell Microbiol. 2007;9:2141–52. DOIPubMedGoogle Scholar
  39. Carlson  JH, Hughes  S, Hogan  D, Cieplak  G, Sturdevant  DE, McClarty  G, Polymorphisms in the Chlamydia trachomatis cytotoxin locus associated with ocular and genital isolates. Infect Immun. 2004;72:7063–72. DOIPubMedGoogle Scholar
  40. Lyons  JM, Ito  JI Jr, Pena  AS, Morre  SA. Differences in growth characteristics and elementary body associated cytotoxicity between Chlamydia trachomatis oculogenital serovars D and H and Chlamydia muridarum. J Clin Pathol. 2005;58:397–401. DOIPubMedGoogle Scholar

Main Article

Page created: July 07, 2010
Page updated: July 07, 2010
Page reviewed: July 07, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external