Volume 16, Number 11—November 2010
Research
Effect of Vaccination on Bordetella pertussis Strains, China
Table
Primer | Sequence, 5′ → 3′ | Gene | Position |
---|---|---|---|
prn-1F | ATGTCTCTGTCACGCATTGTCA | prn | 151–172 |
prn-1R | GTCCTGCATGACGACCAGCTTG | prn | 1653–1632 |
prn-2F | CTCGAACGTCGGTGCGCTAC | prn | 1479–1498 |
prn-2R | TCGCGTCCAGGTAGAAACCG | prn | 2347–2328 |
ptxA-F | GGCACCATCAAAACGCAGAGGGG | ptxA | 476–498 |
ptxA-R | ATTACCGGAGTTGGGCGGGGCTG | ptxA | 1347–1325 |
fim2-F | ACCCATGCAAATCCCTTTCCAACGC | fim2 | 177–201 |
fim2-R | GGGGGTTGGCGATTTCCAGTTTCTC | fim2 | 877–853 |
fim3-F | ATGTCCAAGTTTTCATACCCTGCCT | fim3 | 336–360 |
fim3-R | TTCGTCTCCTGACGCCGCGTAGCGG | fim3 | 1033–1009 |
tcfA-1F | CCACATTGATTCAGGCCGCT | tcfA | 251–270 |
tcfA-1R | CGTCCGCAGGAGACTTGGAA | tcfA | 1096–1077 |
tcfA-2F | GACTCCGGTATGTCCGATTC | tcfA | 976–995 |
tcfA-2R | CTACCAGGCGTAGCGATAGC | tcfA | 2346–2327 |
*Primer positions are listed according to the numbering of the sequences of the following GenBank accession nos.: ptxA, M13223; prn, J04560; fim2, Y00527; fim3, X51543; and tcfA, U16754. prn, pertactin; ptx, pertussis toxin; fim, fimbriae; tcf, tracheal colonization factor.
1These authors contributed equally to this article.
Page created: June 21, 2011
Page updated: June 21, 2011
Page reviewed: June 21, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.