Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 16, Number 5—May 2010
Dispatch

La Crosse Virus in Aedes albopictus Mosquitoes, Texas, USA, 2009

Amy J. LambertComments to Author , Carol D. Blair, Mary D’Anton, Winnann Ewing, Michelle Harborth, Robyn Seiferth, Jeannie Xiang, and Robert S. Lanciotti
Author affiliations: Centers for Disease Control and Prevention, Fort Collins, Colorado, USA (A.J. Lambert, R.S. Lanciotti); Colorado State University, Fort Collins (C.D. Blair); Texas Department of State Health Services, Austin, Texas, USA (M. D’Anton, W. Ewing, M. Harborth, R. Seiferth, J. Xiang)

Main Article

Table

Orthobunyavirus consensus oligonucleotide primers used for amplification and sequencing of La Crosse virus partial S, M, and L segment cDNAs, Texas, 2009*

Targeted genomic regions Name Primer sequence (5′ → 3′) Approximate amplicon size, bp
S segment nucleocapsid ORF Cal S forward GCAAATGGATTTGATCCTGATGCAG 210
Cal S reverse
 TTGTTCCTGTTTGCTGGAAAATGAT
M segment 5′ terminus/glycoprotein ORF Ortho M 5′ terminus AGTAGTGTACTACC 410
Ortho M ORF reverse
 TTRAARCADGCATGGAA
L segment 5′ terminus/polymerase ORF Ortho L 5′ terminus AGTAGTGTACTCCTA 550
Ortho L ORF reverse AATTCYTCATCATCA

*Oligonucleotide primers designed against conserved regions of the orthobunyavirus genome. S segment primers appear in a previous publication (9). All primers were applied in singleplex reactions using methods described previously (9) with altered primer annealing conditions of 50oC for 1 min. S, small; M, medium; L, large; ORF, open reading frame.

Main Article

References
  1. Haddow  AD, Odoi  A. The incidence risk, clustering, and clinical presentation of La Crosse virus infections in the eastern United States, 2003–2007. PLoS ONE. 2009;4:e6145 .DOIPubMedGoogle Scholar
  2. Centers for Disease Control and Prevention. Aedes albopictus introduction—Texas. MMWR Morb Mortal Wkly Rep. 1986;35:141–2.PubMedGoogle Scholar
  3. Moore  CG, Mitchell  CJ. Aedes albopictus in the United States: ten-year presence and public health implications. Emerg Infect Dis. 1997;3:329–34. DOIPubMedGoogle Scholar
  4. Grimstad  PR, Kobayashi  JF, Zhang  MB, Craig  GB Jr. Recently introduced Aedes albopictus in the United States: potential vector of La Crosse virus (Bunyaviridae: California serogroup). J Am Mosq Control Assoc. 1989;5:422–7.PubMedGoogle Scholar
  5. Weaver  SC, Reisen  WK. Present and future arboviral threats. Antiviral Res. 2010;85:328–45. Epub 2009 Oct 24. DOIPubMedGoogle Scholar
  6. Gerhardt  RR, Gottfried  KL, Apperson  CS, Davis  BS, Erwin  PC, Smith  AB, First isolation of La Crosse virus from naturally infected Aedes albopictus. Emerg Infect Dis. 2001;7:807–11. DOIPubMedGoogle Scholar
  7. Klimas  RA, Thompson  WH, Calisher  CH, Clark  GC, Grimstad  PR, Bishop  DH. Genotypic varieties of La Crosse virus isolated from different geographic regions of the continental United States and evidence for a naturally occurring intertypic recombination of La Crosse virus. Am J Epidemiol. 1981;114:112–31.PubMedGoogle Scholar
  8. Lambert  AJ, Lanciotti  RS. Consensus amplification and novel multiplex sequencing method for S segment species identification of 47 viruses of the Orthobunyavirus, Phlebovirus, and Nairovirus genera of the family Bunyaviridae. J Clin Microbiol. 2009;47:2398–404. DOIPubMedGoogle Scholar
  9. Lambert  AJ, Lanciotti  RS. Molecular characterization of medically important viruses of the genus Orthobunyavirus. J Gen Virol. 2008;89:2580–5. DOIPubMedGoogle Scholar
  10. Tamura  K, Dudley  J, Nei  M, Kumar  S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007; 1596–9. Epub 2007 May 7. DOIPubMedGoogle Scholar
  11. Armstrong  PM, Andreadis  TG. A new genetic variant of La Crosse virus (Bunyaviridae) isolated from New England. Am J Trop Med Hyg. 2006;75:491–6.PubMedGoogle Scholar
  12. Tesh  RB, Shroyer  DA. The mechanism of arbovirus transovarial transmission in mosquitoes: San Angelo virus in Aedes albopictus. Am J Trop Med Hyg. 1980;29:1394–404.PubMedGoogle Scholar
  13. Cheng  LL, Rodas  JD, Schultz  KT, Christensen  BM, Yuill  TM, Israel  BA. Potential for evolution of California serogroup bunyaviruses by genome reassortment in Aedes albopictus. Am J Trop Med Hyg. 1999;60:430–8.PubMedGoogle Scholar

Main Article

Page created: December 23, 2010
Page updated: December 23, 2010
Page reviewed: December 23, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external