Volume 16, Number 7—July 2010
Research
Population Structure of East African Relapsing Fever Borrelia spp.
Table 1
Primer and probe sequences used in study of East African relapsing fever Borrelia spp.*
| Primer specificity | Primer/probe sequence, 5′ → 3′ |
|---|---|
| Flagellin forward | CTAGTGGGCATAGAATTAATCGTGC |
| Flagellin reverse | GCTTGGGATAACCCTCTAATTTGA |
| Flagellin probe | fam-TGGTATGGGTGTTGCTGGGAAAATTACG-bhq1 |
| First-round IGS forward | GTATGTTTAGTGAGGGGGGTG |
| First-round IGS reverse | GGATCATAGCTCAGGTGGTTAG |
| Second-round IGS forward | AGGGGGGTGAAGTCGTAACAAG |
| Second-round IGS reverse | GTCTGATAAACCTGAGGTCGGA |
*IGS, intragenic spacer.
Page created: March 02, 2011
Page updated: March 02, 2011
Page reviewed: March 02, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.