Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 17, Number 12—December 2011
Research

Novel Multiplexed HIV/Simian Immunodeficiency Virus Antibody Detection Assay

Steve Ahuka-Mundeke, Ahidjo Ayouba, Placide Mbala-Kingebeni, Florian Liegeois, Amandine Esteban, Octavie Lunguya-Metila, Didace Demba, Guy Bilulu, Valentin Mbenzo-Abokome, Bila-Isia Inogwabini, Jean-Jacques Muyembe-Tamfum, Eric Delaporte, and Martine PeetersComments to Author 
Author affiliations: University of Montpellier, Montpellier, France (S. Ahuka-Mundeke, A. Ayouba, F. Liegeois, A. Esteban, E. Delaporte, M. Peeters); Institut National de Recherche Biomédicales, Kinshasa, Democratic Republic of Congo (S. Ahuka-Mundeke, P. Mbala-Kingebeni, O. Lunguya-Metila, J.-J. Muyembe-Tamfum); Cliniques Universitaires de Kinshasa, Kinshasa (S. Ahuka-Mundeke, P. Mbala-Kingebeni, O. Lunguya-Metila, J.-J. Muyembe-Tamfum); Zone de Santé de Kole, Sankuru, Kasai Oriental, Democratic Republic of Congo (D. Demba, G. Bilulu); World Wildlife Fund For Nature, Kinshasa (V. Mbenzo-Abokome, B-I. Inogwabini)

Main Article

Table 3

Primers used to amplify simian immunodeficiency virus from dried blood spot samples

Primer Sequences, 5′ → 3′* Region targeted Estimated amplicon size, bp References
DR1 TRCAYACAGGRGCWGAYGA pol
800 (8,22)
DR2 AIADRTCATCCATRTAYTG
DR4 GGIATWCCICAYCCDGCAGG 200
DR5
GGIGAYCCYTTCCAYCCYTGHGG
polis4† CCAGCNCACAAAGGNATAGGAGG pol
800 (8,22)
polOR† ACBACYGCNCCTTCHCCTTTC
polis2† TGGCARATRGAYTGYACNCAYNTRGAA 400
uni2†
CCCCTATTCCTCCCCTTCTTTTAAAA
polis4† CCAGCNCACAAAGGNATAGGAGG pol
800 (8,22)
polOR† ACBACYGCNCCTTCHCCTTTC
polis4† CCAGCNCACAAAGGNATAGGAGG 650
uni2†
CCCCTATTCCTCCCCTTCTTTTAAAA
CNMF1 TATCCYTCCYTGTCATCYCTCTTT pol
2,750 (23)
POLor2 ACBACWGCTCCTTCWCCTTTCCA
CNMF2 AATGGAGAATGYTMATAGATTTCAG 2,050
CNMR
CCCCYATTCCTCCCTTTTTTTTA
SPBS GGCGCCCGAACAGGGACTTG gag-pol
2,500 (23)
2500P1 CCTCCTATGTTCCCCTATTTCTCTG
CNM.G1 CGAGGCACTCGGCGATGCTGA 2,200
2500P2
GGAACTGAGAAGGCTGTGTAAGGC
2500L1 CTATCCCCAAACGCATCCGC env-gag
2,000 (23)
CNM.G1rev TCAGCATCGCCGAGTGCCTCG
2500L2 AGAAAAGGGAGGACTGGAAGGGAT 800
SPBSrev
CAAGTCCCTGTTCGGGCGCC
CNMenvF1 TGTGTSAAAYTRACHCCNATGTGTGT env
2,480 (23)
CNMenvR1 AACATNNCYTCYAGTCCTCYCTTTTYT
CNMenvF2 TCCTTYAAYCAGACYACAGARTTYAGRGA 2,140
CNMenvR1
GGGATAGCCANGAATTNTCNCCAT
wrcpolF1 TAGGGACAGAAAGTATAGTAATHTGG pol
1,100 (24)
wrcpolR1 GCCATWGCYAA TGCTGTTTC
wrcpolF2 AGAGACAGTAAGGAAGGGAAAGCAGG 650
wrcpolR2
GTTCWATTCCTAACCACCAGCADA
wrcenvF1 TGGC AGTGGGACAAAAATATAAAC env 750 (24)
wrcenvR1 CTGGCAGTCCCTCTTCCA AGTT GT
wrcenvF2 TGATAGGGMTGGCTCCTGGTGATG 550
wrcenvR2 AATCCCCATTTYAACCAGTTCCA

*R = A or G; M = A or C; W = A or T; S = G or C; Y = C or T; B = C, G, or T; H = A, C, or T; and N = A, C, G, or T.
†Primers that amplifie simian immunodeficiency virus from dried blood spot samples in this study.

Main Article

References
  1. Hahn  BH, Shaw  GM, De Cock  KM, Sharp  PM. AIDS as a zoonosis: scientific and public health implications. Science. 2000;287:60714. DOIPubMed
  2. Keele  BF, Van Heuverswyn  F, Li  Y, Bailes  E, Takehisa  J, Santiago  ML, Chimpanzee reservoirs of pandemic and nonpandemic HIV-1. Science. 2006;313:5236. DOIPubMed
  3. Van Heuverswyn  F, Li  Y, Neel  C, Bailes  E, Keele  BF, Liu  W, Human immunodeficiency viruses: SIV infection in wild gorillas. Nature. 2006;444:164. DOIPubMed
  4. Gao  F, Yue  L, White  AT, Pappas  PG, Barchue  J, Hanson  AP, Human infection by genetically diverse SIVSM-related HIV-2 in west Africa. Nature. 1992;358:4959. DOIPubMed
  5. Hirsch  VM, Olmsted  RA, Murphey-Corb  M, Purcell  RH, Johnson  PR. An African primate lentivirus (SIVsm) closely related to HIV-2. Nature. 1989;339:38992. DOIPubMed
  6. Plantier  JC, Leoz  M, Dickerson  JE, De Oliveira  F, Cordonnier  F, Lemée  V, A new human immunodeficiency virus derived from gorillas. Nat Med. 2009;15:8712. DOIPubMed
  7. Wolfe  ND, Prosser  TA, Carr  JK, Tamoufe  U, Mpoudi-Ngole  E, Torimiro  JN, Exposure to nonhuman primates in rural Cameroon. Emerg Infect Dis. 2004;10:20949.PubMed
  8. Peeters  M, Courgnaud  V, Abela  B, Auzel  P, Pourrut  X, Bibollet-Ruche  F, Risk to human health from a plethora of simian immunodeficiency viruses in primate bushmeat. Emerg Infect Dis. 2002;8:4517.PubMed
  9. Calattini  S, Betsem  EB, Froment  A, Mauclère  P, Tortevoye  P, Schmitt  C, Simian foamy virus transmission from apes to humans, rural Cameroon. Emerg Infect Dis. 2007;13:131420.PubMed
  10. Wolfe  ND, Heneine  W, Carr  JK, Garcia  AD, Shanmugam  V, Tamoufe  U, Emergence of unique primate T-lymphotropic viruses among central African bushmeat hunters. Proc Natl Acad Sci U S A. 2005;102:79949. DOIPubMed
  11. Wolfe  ND, Switzer  WM, Carr  JK, Bhullar  VB, Shanmugam  V, Tamoufe  U, Naturally acquired simian retrovirus infections in central African hunters. Lancet. 2004;363:9327. DOIPubMed
  12. Zheng  H, Wolfe  ND, Sintasath  DM, Tamoufe  U, Lebreton  M, Djoko  CF, Emergence of a novel and highly divergent HTLV-3 in a primate hunter in Cameroon. Virology. 2010;401:13745. DOIPubMed
  13. Van Heuverswyn  F, Peeters  M. The origins of HIV and implications for the global epidemic. Curr Infect Dis Rep. 2007;9:33846. DOIPubMed
  14. Aghokeng  AF, Liu  W, Bibollet-Ruche  F, Loul  S, Mpoudi-Ngole  E, Laurent  C, Widely varying SIV prevalence rates in naturally infected primate species from Cameroon. Virology. 2006;345:17489. DOIPubMed
  15. Aghokeng  AF, Ayouba  A, Mpoudi-Ngole  E, Loul  S, Liegeois  F, Delaporte  E, Extensive survey on the prevalence and genetic diversity of SIVs in primate bushmeat provides insights into risks for potential new cross-species transmissions. Infect Genet Evol. 2010;10:38696. DOIPubMed
  16. Simon  F, Souquière  S, Damond  F, Kfutwah  A, Makuwa  M, Leroy  E, Synthetic peptide strategy for the detection of and discrimination among highly divergent primate lentiviruses. AIDS Res Hum Retroviruses. 2001;17:93752. DOIPubMed
  17. Ndongmo  CB, Switzer  WM, Pau  CP, Zeh  C, Schaefer  A, Pieniazek  D, New multiple antigenic peptide-based enzyme immunoassay for detection of simian immunodeficiency virus infection in nonhuman primates and humans. J Clin Microbiol. 2004;42:51619. DOIPubMed
  18. Bernhard  OK, Mathias  RA, Barnes  TW, Simpson  RJ. A fluorescent microsphere-based method for assay of multiple analytes in plasma. Methods Mol Biol. 2011;728:195206. DOIPubMed
  19. Crowther  JR. The ELISA guidebook. In: Walker JM, editor. Methods in molecular biology. Vol. 149. Totowa (NJ): Humana Press: Totowa, NJ; 2001.
  20. Monleau  M, Montavon  C, Laurent  C, Segondy  M, Montes  B, Delaporte  E, Evaluation of different RNA extraction methods and storage conditions of dried plasma or blood spots for human immunodeficiency virus type 1 RNA quantification and PCR amplification for drug resistance testing. J Clin Microbiol. 2009;47:110718. DOIPubMed
  21. Van Der Kuyl  AC, Van Gennep  DR, Dekker  JT, Goudsmit  J. Routine DNA analysis based on 12S rRNA gene sequencing as a tool in the management of captive primates. J Med Primatol. 2000;29:30715. DOIPubMed
  22. Clewley  JP, Lewis  JC, Brown  DW, Gadsby  EL. A novel simian immunodeficiency virus (SIVdrl) pol sequence from the drill monkey, Mandrillus leucophaeus. J Virol. 1998;72:103059.PubMed
  23. Aghokeng  AF, Bailes  E, Loul  S, Courgnaud  V, Mpoudi-Ngole  E, Sharp  PM, Full-length sequence analysis of SIVmus in wild populations of mustached monkeys (Cercopithecus cephus) from Cameroon provides evidence for two co-circulating SIVmus lineages. Virology. 2007;360:40718. DOIPubMed
  24. Liégeois  F, Lafay  B, Formenty  P, Locatelli  S, Courgnaud  V, Delaporte  E, Full-length genome characterization of a novel simian immunodeficiency virus lineage (SIVolc) from olive Colobus (Procolobus verus) and new SIVwrcPbb strains from Western Red Colobus (Piliocolobus badius badius) from the Tai Forest in Ivory Coast. J Virol. 2009;83:42839. DOIPubMed
  25. Larkin  MA, Blackshields  G, Brown  NP, Chenna  R, McGettigan  PA, McWilliam  H, Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:29478. DOIPubMed
  26. Milne  I, Lindner  D, Bayer  M, Husmeier  D, McGuire  G, Marshall  DF, TOPALi v2: a rich graphical interface for evolutionary analyses of multiple alignments on HPC clusters and multi-core desktops. Bioinformatics. 2009;25:1267. DOIPubMed
  27. Guindon  S, Gascuel  O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol. 2003;52:696704. DOIPubMed
  28. Groves  C. Primate taxonomy. Smithsonian Series in Comparative Evolutionary Biology. Washington: Smithsonian Institution Press; 2001.
  29. Goldberg  TL, Sintasath  DM, Chapman  CA, Cameron  KM, Karesh  WB, Tang  S, Coinfection of Ugandan red colobus (Procolobus [Piliocolobus] rufomitratus tephrosceles) with novel, divergent delta-, lenti-, and spumaretroviruses. J Virol. 2009;83:1131829. DOIPubMed
  30. Verschoor  EJ, Fagrouch  Z, Bontjer  I, Niphuis  H, Heeney  JL. A novel simian immunodeficiency virus isolated from a Schmidt’s guenon (Cercopithecus ascanius schmidti). J Gen Virol. 2004;85:214. DOIPubMed
  31. Takemura  T, Ekwalanga  M, Bikandou  B, Ido  E, Yamaguchi-Kabata  Y, Ohkura  S, A novel simian immunodeficiency virus from black mangabey (Lophocebus aterrimus) in the Democratic Republic of Congo. J Gen Virol. 2005;86:196771. DOIPubMed
  32. Aghokeng  AF, Ayouba  A, Ahuka  S, Liegois  F, Mbala  P, Muyembe  JJ, Genetic diversity of simian lentivirus in wild De Brazza’s monkeys (Cercopithecus neglectus) in equatorial Africa. J Gen Virol. 2010;91:18106. DOIPubMed
  33. Parrish  CR, Holmes  EC, Morens  DM, Park  EC, Burke  DS, Calisher  CH, Cross-species virus transmission and the emergence of new epidemic diseases. Microbiol Mol Biol Rev. 2008;72:45770. DOIPubMed
  34. Santiago  ML, Range  F, Keele  BF, Li  Y, Bailes  E, Bibollet-Ruche  F, Simian immunodeficiency virus infection in free-ranging sooty mangabeys (Cercocebus atys atys) from the Tai Forest, Côte d'Ivoire: implications for the origin of epidemic human immunodeficiency virus type 2. J Virol. 2005;79:1251527. DOIPubMed
  35. Switzer  W, Ahuka-Mundeke  S, Tang  S, Shankar  A, Wolfe  N, Heneine  W, SFV infection from Colobus monkeys in women from Democratic Republic of Congo. 18th Conference on Retroviruses and Opportunistic Infections, Boston, Feb 27−March 2, 2011. Paper no. 454.
  36. US Agency for International Development HIV/AIDS. Democratic Republic of Congo [cited 2011 Sep 28].) http://www.usaid.gov/our_work/global_health/aids/Countries/africa/congo.html
  37. Vidal  N, Peeters  M, Mulanga-Kabeya  C, Nzilambi  N, Robertson  D, Ilunga  W, Unprecedented degree of human immunodeficiency virus type 1 (HIV-1) group M genetic diversity in the Democratic Republic of Congo suggests that the HIV-1 pandemic originated in Central Africa. J Virol. 2000;74:10498507. DOIPubMed
  38. Braeckman  C. Les nouveaux predateurs. Politique des puissances en Afrique centrale. Paris: Fayard; 2003.
  39. Laurent  C, Bourgeois  A, Mpoudi  M, Butel  C, Peeters  M, Mpoudi-Ngolé  E, Commercial logging and HIV epidemic, rural Equatorial Africa. Emerg Infect Dis. 2004;10:19536.PubMed
  40. Mulanga  C, Bazepeo  SE, Mwamba  JK, Butel  C, Tshimpaka  JW, Kashi  M, Political and socioeconomic instability: how does it affect HIV? A case study in the Democratic Republic of Congo. AIDS. 2004;18:8324. DOIPubMed

Main Article

Page created: November 30, 2011
Page updated: November 30, 2011
Page reviewed: November 30, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external