Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 17, Number 5—May 2011
Dispatch

Tick-Borne Encephalitis Virus, Kyrgyzstan

Benjamin J. BriggsComments to Author , Barry Atkinson, Donna M. Czechowski, Peter A. Larsen, Heather N. Meeks, Juan P. Carrera, Ryan M. Duplechin, Roger Hewson, Asankadyr T. Junushov, Olga N. Gavrilova, Irena Breininger, Carleton J. Phillips, Robert J. Baker, and John Hay
Author affiliations: Author affiliations: State University of New York, Buffalo, New York, USA (B.J. Briggs, D.M. Czechowski, J. Hay); Health Protection Agency, Porton Down, Salisbury, UK (B. Atkinson, R. Hewson); Texas Tech University, Lubbock, Texas, USA (P.A. Larsen, H.N. Meeks, J.P. Carrera, R.M. Duplechin, C.J. Phillips, R.J. Baker); National Academy of Sciences of the Kyrgyz Republic, Bishkek, Kyrgyz Republic (A.T. Junushov); Ministry of Healthcare of the Kyrgyz Republic, Bishkek (O.N. Gavrilova, I. Breininger)

Main Article

Table 2

Primers used to test rodents, insectivores, and ticks for tick-borne encephalitis virus, Kyrgyzstan, 2007 and 2009*

Primer Gene Sequence, 5′ → 3′ Reference
FSM-1 NS5 GAGGCTGAACAACTGCACGA (8)
FSM-2 NS5 GAACACGTCCATTCCTGATCT (8)
FSM-1i NS5 ACGGAACGTGACAAGGCTAG (8)
FSM-2i NS5 GCTTGTTACCATCTTTGGAG (8)
TBEV913F E TGCACACAYYTGGAAAACAGGGA (9)
TBEV1738R E TGGCCACTTTTCAGGTGGTACTTGGTTCC (9)
RH TBE forward E GGCAGCATTGTGACCTGTGT R. Hewson, unpub. data
RH TBE reverse E CGTGTCCTGTGGCTTTCTTTTT R. Hewson, unpub. data
RH TBE probe E 6FAM-AGGYGKCYTGTGAGGC-MGB NFQ R. Hewson, unpub. data

*TBEV, tick-borne encephalitis virus; NS, nonstructural protein; E, envelope.

Main Article

References
  1. Lindenbach  BD, Thiel  H-J, Rice  CM. Flaviviridae: the viruses and their replication. In: Knipe DM, Howley PM, editors. Fields’ virology. 5th ed. Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins; 2007. p. 1101–52.
  2. Randolph  SE. Tick-borne encephalitis virus, ticks and humans: short-term and long-term dynamics. Curr Opin Infect Dis. 2008;21:462–7. DOIPubMedGoogle Scholar
  3. Lindquist  L, Vapalahti  O. Tick-borne encephalitis. Lancet. 2008;371:1861–71. DOIPubMedGoogle Scholar
  4. Holzmann  H, Aberle  SW, Stiasny  K, Werner  P, Mischak  A, Zainer  B, Tick-borne encephalitis from eating goat cheese in a mountain region of Austria. Emerg Infect Dis. 2009;15:1671–3.PubMedGoogle Scholar
  5. Kyrgyzstan  CIA. The world factbook; 2009 [cited 2009 Dec 27]. https://www.cia.gov/library/publications/the-world-factbook/geos/kg.html
  6. Holbrook  MR, Shope  RE, Barrett  AD. Use of recombinant E protein domain III-based enzyme-linked immunosorbent assays for differentiation of tick-borne encephalitis serocomplex flaviviruses from mosquito-borne flaviviruses. J Clin Microbiol. 2004;42:4101–10. DOIPubMedGoogle Scholar
  7. Niedrig  M, Vaisviliene  D, Teichmann  A, Klockmann  U, Biel  SS. Comparison of six different commercial IgG-ELISA kits for the detection of TBEV-antibodies. J Clin Virol. 2001;20:179–82. DOIPubMedGoogle Scholar
  8. Puchhammer-Stöckl  E, Kunz  C, Mandl  CW, Heinz  FX. Identification of tick-borne encephalitis virus ribonucleic acid in tick suspensions and in clinical specimens by a reverse transcription–nested polymerase chain reaction assay. Clin Diagn Virol. 1995;4:321–6. DOIPubMedGoogle Scholar
  9. Ternovoi  VA, Kurzhukov  GP, Sokolov  YV, Ivanov  GY, Ivanisenko  VA, Loktev  AV, Tick-borne encephalitis with hemorrhagic syndrome, Novosibirsk region, Russia, 1999. Emerg Infect Dis. 2003;9:743–6.PubMedGoogle Scholar
  10. Ecker  M, Allison  SL, Meixner  T, Heinz  FX. Sequence analysis and genetic classification of tick-borne encephalitis viruses from Europe and Asia. J Gen Virol. 1999;80:179–85.PubMedGoogle Scholar
  11. Bakhvalova  VN, Potapova  OF, Panov  VV, Morozova  OV. Vertical transmission of tick-borne encephalitis virus between generations of adapted reservoir small rodents. Virus Res. 2009;140:172–8. DOIPubMedGoogle Scholar
  12. Labuda  M, Nuttall  PA, Kozuch  O, Eleckova  E, Williams  T, Zuffova  E, Non-viraemic transmission of tick-borne encephalitis virus: a mechanism for arbovirus survival in nature. Experientia. 1993;49:802–5. DOIPubMedGoogle Scholar
  13. Randolph  SE, Green  RM, Peacey  MF, Rogers  DJ. Seasonal synchrony: the key to tick-borne encephalitis foci identified by satellite data. Parasitology. 2000;121:15–23. DOIPubMedGoogle Scholar
  14. Phillips  CJ. Harrington AM., Yates TL, Simpson GL, Baker RJ. Global disease surveillance, emergent disease preparedness, and national security. Lubbock (TX): Museum of Texas Tech University; 2009.

Main Article

Page created: August 08, 2011
Page updated: August 08, 2011
Page reviewed: August 08, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external