Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 17, Number 7—July 2011

Research

Asian Lineage of Peste des Petits Ruminants Virus, Africa

Olivier Kwiatek, Yahia Hassan Ali, Intisar Kamil Saeed, Abdelmelik Ibrahim Khalafalla, Osama Ishag Mohamed, Ali Abu Obeida, Magdi Badawi Abdelrahman, Halima Mohamed Osman, Khalid Mohamed Taha, Zakia Abbas, Mehdi El Harrak, Youssef Lhor, Adama Diallo, Renaud Lancelot, Emmanuel Albina, and Geneviève LibeauComments to Author 
Author affiliations: Author affiliations: Control of Exotic and Emerging Animal Diseases, Montpellier, France (O. Kwiatek, R. Lancelot, E. Albina, G. Libeau); Central Veterinary Research Laboratories, Soba, Sudan (Y.H. Ali, I.K. Saeed, M.B. Abdelrahman, H.M. Osman, Z. Abbas); University of Khartoum, Shambat, Sudan (A.I. Khalafalla, A.A. Obeida); Rabak Veterinary Research Laboratory, White Nile State, Sudan (O.I. Mohamed); Atbara Veterinary Research Laboratory, River Nile State, Sudan (K.M. Taha); Biopharama, Rabat, Morocco (M. El Harrak, Y. Lhor); International Atomic Energy Agency, Vienna, Austria (A. Diallo)

Main Article

Table 3

Multiple sequence alignment of F1/F2 primers and FPPRrev target sites from different PPRV isolates of lineage II compared with isolates of lineage IV*

PPRV isolate† F1 (primer 5′), nt 777–801 F2 (primer 3′), nt 1124–1148 FPPRrev (primer 3′), nt 2055–2079
NIGERIA 75_1‡ ATCACAGTGTTAAAGCCTGTAGAGG GCTTGTAGGTCACAAACTCAGTCTC TCCCTAGGGCTTGTCACATTAATAT
NIGERIA 76_1 ------------------------- ---G--------------------- -------------------------
ICV 89 ------------------------- ------------------------- -------------------------
SUNGRI 96 ------------------------- ---G-----------G---G-C--- -------------------------
China/TibetGeg07-30 --------------A---------- ---G-----C-----G---G-C--- -------------------------
TURKEY 00 ------------------------- ---G-----------G---G-C--- -------------------------

*FPPRrev, new reverse primer designed in this study; PPRV, peste des petits ruminants virus. Nucleotide position (numbered according to GenBank accession no. X74443 sequence). The consensus sequence corresponds to the F gene of the PPRV Nigeria 75_1 vaccine strain. F1/F2 primers from (8).
†Lineage and GenBank accession nos.: NIGERIA 75_1, lineage II, X74443; NIGERIA 76_1, lineage II, EU267274; ICV 89, lineage I, EU267273; SUNGRI 96, lineage IV, AY560591, China/TibetGeg07-30, lineage IV, FJ905304; TURKEY 00, lineage IV, AJ849636.
‡Vaccine strain.

Main Article

References
  1. Gibbs  EPJ, Taylor  WP, Lawman  MPJ, Bryant  J. Classification of the peste des petits ruminants virus as the fourth member of the genus Morbillivirus. Intervirology. 1979;11:268–74. DOIPubMedGoogle Scholar
  2. El Hag Ali  B, Taylor  WP. Isolation of peste des petits ruminants virus from Sudan. Res Vet Sci. 1984;36:1–4.PubMedGoogle Scholar
  3. Shaila  MS, Shamaki  D, Forsyth  MA, Diallo  A, Kitching  RP, Barrett  T. Geographic distribution and epidemiology of peste des petits ruminants virus. Virus Res. 1996;43:149–53. DOIPubMedGoogle Scholar
  4. Lefèvre  PC, Diallo  A. Peste des petits ruminants. Rev Sci Tech. 1990;9:935–81.PubMedGoogle Scholar
  5. Taylor  WP, Barrett  T. Peste de petits ruminants and rinderpest. In: Aitken ID, editor. Diseases of sheep, 4th ed. Oxford: Blackwells Science; 2007. p. 460–8.
  6. Roeder  PL. The animal story. BMJ. 2005;331:1262–4. DOIPubMedGoogle Scholar
  7. World Organisation for Animal Health. Immediate notifications and follow-up reports. World Animal Health Information Database (WAHID) Interface; 2009 [cited 2009 Jan 27]. http://www.oie.int/wahis/public.php?page=reports_pdf_download
  8. Forsyth  MA, Barrett  T. Evaluation of polymerase chain reaction for the detection and characterisation of rinderpest and peste des petits ruminants viruses for epidemiological studies. Virus Res. 1995;39:151–63. DOIPubMedGoogle Scholar
  9. Ozkul  A, Akca  Y, Alkan  F, Barrett  T, Karaoglu  T, Dagalp  SB, Prevalence, distribution, and host range of peste des petits ruminants virus, Turkey. Emerg Infect Dis. 2002;8:708–12.PubMedGoogle Scholar
  10. Kwiatek  O, Minet  C, Grillet  C, Hurard  C, Carlsson  E, Karimov  B, Peste des petits ruminants (PPR) outbreak in Tajikistan. J Comp Pathol. 2007;136:111–9. DOIPubMedGoogle Scholar
  11. Chard  LS, Bailey  DS, Dash  P, Banyard  AC, Barrett  T. Full genome sequences of two virulent strains of peste-des-petits ruminants virus, the Côte d'Ivoire 1989 and Nigeria 1976 strains. Virus Res. 2008;136:192–7. DOIPubMedGoogle Scholar
  12. Barrett  T, Banyard  AC, Diallo  A. Molecular biology of the morbilliviruses. In: Barrett T, Pastouret PP, Taylor WP, editors. Rinderpest and peste des petits ruminants virus. London: Academic Press; 2006. p. 31–56.
  13. Ali B el-H. A natural outbreak of rinderpest involving sheep, goats and cattle in Sudan. [PMID: 4807688]. Bull Epizoot Dis Afr. 1973;12:421–8.
  14. Govindarajan  R, Koteeswaran  A, Venugopalan  AT, Shyam  G, Shaouna  S, Shaila  MS, Isolation of peste des petits ruminants virus from an outbreak in Indian buffalo (Bubalus bubalis). Vet Rec. 1997;141:573–4. DOIPubMedGoogle Scholar
  15. Saeed  IK, Ali  YH, Khalafalla  AI, Rahman-Mahasin  EA. Current situation of peste des petits ruminants (PPR) in the Sudan. Trop Anim Health Prod. 2010;42:89–93. DOIPubMedGoogle Scholar
  16. Khalafalla  AI, Saeed  IK, Ali  YH, Abdurrahman  MB, Kwiatek  O, Libeau  G, An outbreak of peste des petits ruminants (PPR) in camels in the Sudan. Acta Trop. 2010;116:161–5. DOIPubMedGoogle Scholar
  17. Roger  F, Guebre Yesus  M, Libeau  G, Diallo  A, Yigezu  LM, Yilma  T. Detection of antibodies of rinderpest and peste des petits ruminants viruses (Paramyxoviridae, Morbillivirus) during a new epizootic disease in Ethiopian camels (Camelus dromedarius). Rev Med Vet (Toulouse). 2001;152:265–8.
  18. Sanz-Alvarez  J, Diallo  A, De La Rocque  S, Pinto  J, Thevenet  S, Lubroth  J. Peste des petits ruminants (PPR) in Morocco. EMPRES Watch, 2008 August 1–7 [cited 2009 Jan 27]. ftp://ftp.fao.org/docrep/fao/011/aj120f/aj120f00.pdf
  19. Couacy-Hymann  E, Roger  F, Hurard  C, Guillou  JP, Libeau  G, Diallo  A. Rapid and sensitive detection of peste des petits ruminants virus by a polymerase chain reaction assay. J Virol Methods. 2002;100:17–25. DOIPubMedGoogle Scholar
  20. Banyard  AC, Parida  S, Batten  C, Oura  C, Kwiatek  O, Libeau  G. Global distribution of peste des petits ruminants virus and prospects for improved diagnosis and control. J Gen Virol. 2010;91:2885–97. DOIPubMedGoogle Scholar
  21. Kerur  N, Jhala  MK, Joshi  CG. Genetic characterization of Indian peste des petits ruminants virus (PPRV) by sequencing and phylogenetic analysis of fusion protein and nucleoprotein gene segments. Res Vet Sci. 2008;85:176–83. DOIPubMedGoogle Scholar
  22. Wang  Z, Bao  J, Wu  X, Liu  Y, Li  L, Liu  C, Peste des petits ruminants virus in Tibet, China. Emerg Infect Dis. 2009;15:299–301. DOIPubMedGoogle Scholar
  23. Saitou  N, Nei  M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–25.PubMedGoogle Scholar
  24. Perrier  X, Flori  A, Bonnet  F. Data analysis methods. In: Hamos P, Seguin M, Perrier X, Glaszmann JC, editors. Genetic diversity of cultivated tropical plants. Montpellier (France): Gifield Science Publishers; 2003. p. 43–76.
  25. Gascuel  O. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Mol Biol Evol. 1997;14:685–95.PubMedGoogle Scholar
  26. Van de peer Y, DeWatchter R. Treecon: a software package for the construction and drawing of evolutionary trees. Comput Appl Biosci. 1993;9:177–82.PubMedGoogle Scholar
  27. Seki  F, Ono  N, Yamaguchi  R, Yanagi  Y. Efficient isolation of wild strains of canine distemper virus in Vero cells expressing canine SLAM (CD150) and their adaptability to marmoset B95a cells. J Virol. 2003;77:9943–50. DOIPubMedGoogle Scholar
  28. Taylor  WP, al Busaidy  S, Barrett  T. The epidemiology of peste des petits ruminants in the Sultanate of Oman. Vet Microbiol. 1990;22:341–52. DOIPubMedGoogle Scholar
  29. Furley  CW, Taylor  WP, Obi  TU. An outbreak of peste des petits ruminants in a zoological collection. Vet Rec. 1987;121:443–7. DOIPubMedGoogle Scholar
  30. Ayari-Fakhfakh  E, Ghram  A, Bouattour  A, Larbi  I, Gribâa-Dridi  L, Kwiatek  O, First serological investigation of peste-des-petits ruminants and Rift Valley fever in Tunisia. [PMID: 20167519]. Vet J. 2011;187:402–4. DOIPubMedGoogle Scholar
  31. El Mubarak  HS, van de Bildt  MW, Mustafa  OA, Vos  HW, Mukhtar  MM, Ibrahim  SA, Genetic characterization of wild-type measles viruses circulating in suburban Khartoum, 1997–2000. J Gen Virol. 2002;83:1437–43.PubMedGoogle Scholar
  32. Ismail  TM, Hassas  HB, Nawal  M, Rakha  GM, Abd El-Halim  MM, Fatebia  MM. Studies on prevalence of rinderpest and peste des petits ruminants antibodies in camel sera in Egypt. Vet Med J Giza. 1992;10:49–53.
  33. Haroun  M, Hajer  I, Mukhtar  M, Ali  BE. Detection of antibodies against peste des petits ruminants virus in sera of cattle, camels, sheep and goats in Sudan. Vet Res Commun. 2002;26:537–41. DOIPubMedGoogle Scholar
  34. Abraham  G, Sintayehu  A, Libeau  G, Albina  E, Roger  F, Laekemariam  Y, Antibody seroprevalences against peste des petits ruminants (PPR) virus in camels, cattle, goats, and sheep in Ethiopia. Prev Vet Med. 2005;70:51–7. DOIPubMedGoogle Scholar
  35. Abubakar  A, Sanda  AB, El-Yuduga  A, Baba  SS. Seroprevalence of Morbillivirus antibody and abattoir survey of one-humped slaughtered camels (Camelus dromedarius) in Maiduguri municipal abattoir, Maiduguri, Nigeria. Asian J Sci Res. 2008;1:85–9. DOIGoogle Scholar
  36. Albayrak  H, Gür  S. A serologic investigation for peste des petits ruminants infection in sheep, cattle, and camels (Camelus dromedarius) in Aydın province, West Anatolia. Trop Anim Health Prod. 2010;42:151–3. DOIPubMedGoogle Scholar
  37. Roger  F, Yigezu  LM, Hurard  C, Libeau  G, Mebratu  G, Diallo  A, Investigations on a new pathological condition of camels in Ethiopia. Journal of Camel Practice and Research. 2000;7:163–5.
  38. Taylor  WP. The distribution and epidemiology of peste des petits ruminants. Prev Vet Med. 1984;2:157–66. DOIGoogle Scholar

Main Article

Page created: August 15, 2011
Page updated: August 15, 2011
Page reviewed: August 15, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external