Volume 17, Number 7—July 2011
Research
Asian Lineage of Peste des Petits Ruminants Virus, Africa
Table 3
Multiple sequence alignment of F1/F2 primers and FPPRrev target sites from different PPRV isolates of lineage II compared with isolates of lineage IV*
PPRV isolate† | F1 (primer 5′), nt 777–801 | F2 (primer 3′), nt 1124–1148 | FPPRrev (primer 3′), nt 2055–2079 |
---|---|---|---|
NIGERIA 75_1‡ | ATCACAGTGTTAAAGCCTGTAGAGG | GCTTGTAGGTCACAAACTCAGTCTC | TCCCTAGGGCTTGTCACATTAATAT |
NIGERIA 76_1 | ------------------------- | ---G--------------------- | ------------------------- |
ICV 89 | ------------------------- | ------------------------- | ------------------------- |
SUNGRI 96 | ------------------------- | ---G-----------G---G-C--- | ------------------------- |
China/TibetGeg07-30 | --------------A---------- | ---G-----C-----G---G-C--- | ------------------------- |
TURKEY 00 | ------------------------- | ---G-----------G---G-C--- | ------------------------- |
*FPPRrev, new reverse primer designed in this study; PPRV, peste des petits ruminants virus. Nucleotide position (numbered according to GenBank accession no. X74443 sequence). The consensus sequence corresponds to the F gene of the PPRV Nigeria 75_1 vaccine strain. F1/F2 primers from (8).
†Lineage and GenBank accession nos.: NIGERIA 75_1, lineage II, X74443; NIGERIA 76_1, lineage II, EU267274; ICV 89, lineage I, EU267273; SUNGRI 96, lineage IV, AY560591, China/TibetGeg07-30, lineage IV, FJ905304; TURKEY 00, lineage IV, AJ849636.
‡Vaccine strain.
References
- Gibbs EPJ, Taylor WP, Lawman MPJ, Bryant J. Classification of the peste des petits ruminants virus as the fourth member of the genus Morbillivirus. Intervirology. 1979;11:268–74. DOIPubMedGoogle Scholar
- El Hag Ali B, Taylor WP. Isolation of peste des petits ruminants virus from Sudan. Res Vet Sci. 1984;36:1–4.PubMedGoogle Scholar
- Shaila MS, Shamaki D, Forsyth MA, Diallo A, Kitching RP, Barrett T. Geographic distribution and epidemiology of peste des petits ruminants virus. Virus Res. 1996;43:149–53. DOIPubMedGoogle Scholar
- Taylor WP, Barrett T. Peste de petits ruminants and rinderpest. In: Aitken ID, editor. Diseases of sheep, 4th ed. Oxford: Blackwells Science; 2007. p. 460–8.
- World Organisation for Animal Health. Immediate notifications and follow-up reports. World Animal Health Information Database (WAHID) Interface; 2009 [cited 2009 Jan 27]. http://www.oie.int/wahis/public.php?page=reports_pdf_download
- Forsyth MA, Barrett T. Evaluation of polymerase chain reaction for the detection and characterisation of rinderpest and peste des petits ruminants viruses for epidemiological studies. Virus Res. 1995;39:151–63. DOIPubMedGoogle Scholar
- Ozkul A, Akca Y, Alkan F, Barrett T, Karaoglu T, Dagalp SB, Prevalence, distribution, and host range of peste des petits ruminants virus, Turkey. Emerg Infect Dis. 2002;8:708–12.PubMedGoogle Scholar
- Kwiatek O, Minet C, Grillet C, Hurard C, Carlsson E, Karimov B, Peste des petits ruminants (PPR) outbreak in Tajikistan. J Comp Pathol. 2007;136:111–9. DOIPubMedGoogle Scholar
- Chard LS, Bailey DS, Dash P, Banyard AC, Barrett T. Full genome sequences of two virulent strains of peste-des-petits ruminants virus, the Côte d'Ivoire 1989 and Nigeria 1976 strains. Virus Res. 2008;136:192–7. DOIPubMedGoogle Scholar
- Barrett T, Banyard AC, Diallo A. Molecular biology of the morbilliviruses. In: Barrett T, Pastouret PP, Taylor WP, editors. Rinderpest and peste des petits ruminants virus. London: Academic Press; 2006. p. 31–56.
- Ali B el-H. A natural outbreak of rinderpest involving sheep, goats and cattle in Sudan. [PMID: 4807688]. Bull Epizoot Dis Afr. 1973;12:421–8.
- Govindarajan R, Koteeswaran A, Venugopalan AT, Shyam G, Shaouna S, Shaila MS, Isolation of peste des petits ruminants virus from an outbreak in Indian buffalo (Bubalus bubalis). Vet Rec. 1997;141:573–4. DOIPubMedGoogle Scholar
- Saeed IK, Ali YH, Khalafalla AI, Rahman-Mahasin EA. Current situation of peste des petits ruminants (PPR) in the Sudan. Trop Anim Health Prod. 2010;42:89–93. DOIPubMedGoogle Scholar
- Khalafalla AI, Saeed IK, Ali YH, Abdurrahman MB, Kwiatek O, Libeau G, An outbreak of peste des petits ruminants (PPR) in camels in the Sudan. Acta Trop. 2010;116:161–5. DOIPubMedGoogle Scholar
- Roger F, Guebre Yesus M, Libeau G, Diallo A, Yigezu LM, Yilma T. Detection of antibodies of rinderpest and peste des petits ruminants viruses (Paramyxoviridae, Morbillivirus) during a new epizootic disease in Ethiopian camels (Camelus dromedarius). Rev Med Vet (Toulouse). 2001;152:265–8.
- Sanz-Alvarez J, Diallo A, De La Rocque S, Pinto J, Thevenet S, Lubroth J. Peste des petits ruminants (PPR) in Morocco. EMPRES Watch, 2008 August 1–7 [cited 2009 Jan 27]. ftp://ftp.fao.org/docrep/fao/011/aj120f/aj120f00.pdf
- Couacy-Hymann E, Roger F, Hurard C, Guillou JP, Libeau G, Diallo A. Rapid and sensitive detection of peste des petits ruminants virus by a polymerase chain reaction assay. J Virol Methods. 2002;100:17–25. DOIPubMedGoogle Scholar
- Banyard AC, Parida S, Batten C, Oura C, Kwiatek O, Libeau G. Global distribution of peste des petits ruminants virus and prospects for improved diagnosis and control. J Gen Virol. 2010;91:2885–97. DOIPubMedGoogle Scholar
- Kerur N, Jhala MK, Joshi CG. Genetic characterization of Indian peste des petits ruminants virus (PPRV) by sequencing and phylogenetic analysis of fusion protein and nucleoprotein gene segments. Res Vet Sci. 2008;85:176–83. DOIPubMedGoogle Scholar
- Wang Z, Bao J, Wu X, Liu Y, Li L, Liu C, Peste des petits ruminants virus in Tibet, China. Emerg Infect Dis. 2009;15:299–301. DOIPubMedGoogle Scholar
- Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–25.PubMedGoogle Scholar
- Perrier X, Flori A, Bonnet F. Data analysis methods. In: Hamos P, Seguin M, Perrier X, Glaszmann JC, editors. Genetic diversity of cultivated tropical plants. Montpellier (France): Gifield Science Publishers; 2003. p. 43–76.
- Gascuel O. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Mol Biol Evol. 1997;14:685–95.PubMedGoogle Scholar
- Van de peer Y, DeWatchter R. Treecon: a software package for the construction and drawing of evolutionary trees. Comput Appl Biosci. 1993;9:177–82.PubMedGoogle Scholar
- Seki F, Ono N, Yamaguchi R, Yanagi Y. Efficient isolation of wild strains of canine distemper virus in Vero cells expressing canine SLAM (CD150) and their adaptability to marmoset B95a cells. J Virol. 2003;77:9943–50. DOIPubMedGoogle Scholar
- Taylor WP, al Busaidy S, Barrett T. The epidemiology of peste des petits ruminants in the Sultanate of Oman. Vet Microbiol. 1990;22:341–52. DOIPubMedGoogle Scholar
- Furley CW, Taylor WP, Obi TU. An outbreak of peste des petits ruminants in a zoological collection. Vet Rec. 1987;121:443–7. DOIPubMedGoogle Scholar
- Ayari-Fakhfakh E, Ghram A, Bouattour A, Larbi I, Gribâa-Dridi L, Kwiatek O, First serological investigation of peste-des-petits ruminants and Rift Valley fever in Tunisia. [PMID: 20167519]. Vet J. 2011;187:402–4. DOIPubMedGoogle Scholar
- El Mubarak HS, van de Bildt MW, Mustafa OA, Vos HW, Mukhtar MM, Ibrahim SA, Genetic characterization of wild-type measles viruses circulating in suburban Khartoum, 1997–2000. J Gen Virol. 2002;83:1437–43.PubMedGoogle Scholar
- Ismail TM, Hassas HB, Nawal M, Rakha GM, Abd El-Halim MM, Fatebia MM. Studies on prevalence of rinderpest and peste des petits ruminants antibodies in camel sera in Egypt. Vet Med J Giza. 1992;10:49–53.
- Haroun M, Hajer I, Mukhtar M, Ali BE. Detection of antibodies against peste des petits ruminants virus in sera of cattle, camels, sheep and goats in Sudan. Vet Res Commun. 2002;26:537–41. DOIPubMedGoogle Scholar
- Abraham G, Sintayehu A, Libeau G, Albina E, Roger F, Laekemariam Y, Antibody seroprevalences against peste des petits ruminants (PPR) virus in camels, cattle, goats, and sheep in Ethiopia. Prev Vet Med. 2005;70:51–7. DOIPubMedGoogle Scholar
- Abubakar A, Sanda AB, El-Yuduga A, Baba SS. Seroprevalence of Morbillivirus antibody and abattoir survey of one-humped slaughtered camels (Camelus dromedarius) in Maiduguri municipal abattoir, Maiduguri, Nigeria. Asian J Sci Res. 2008;1:85–9. DOIGoogle Scholar
- Albayrak H, Gür S. A serologic investigation for peste des petits ruminants infection in sheep, cattle, and camels (Camelus dromedarius) in Aydın province, West Anatolia. Trop Anim Health Prod. 2010;42:151–3. DOIPubMedGoogle Scholar
- Roger F, Yigezu LM, Hurard C, Libeau G, Mebratu G, Diallo A, Investigations on a new pathological condition of camels in Ethiopia. Journal of Camel Practice and Research. 2000;7:163–5.
- Taylor WP. The distribution and epidemiology of peste des petits ruminants. Prev Vet Med. 1984;2:157–66. DOIGoogle Scholar
Page created: August 15, 2011
Page updated: August 15, 2011
Page reviewed: August 15, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.