Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 18, Number 4—April 2012
Dispatch

Cosavirus Infection in Persons with and without Gastroenteritis, Brazil

Andreas Stöcker1, Breno Frederico de Carvalho Dominguez Souza1, Tereza Cristina Medrado Ribeiro1, Eduardo Martins Netto, Luciana Oliveira Araujo, Jefferson Ivan Corrêa, Patrícia Silva Almeida, Angela Peixoto de Mattos, Hugo da Costa Ribeiro, Diana Brasil Pedral-Sampaio, Christian Drosten, and Jan Felix DrexlerComments to Author 
Author affiliations: University of Bonn Medical Centre, Bonn, Germany (A. Stöcker, C. Drosten, J.F. Drexler); Federal University of Bahia, Salvador, Brazil (A. Stocker, B.F.C.D. Souza, T.C.M. Ribeiro, E.M. Netto, L.O. Araujo, J.I. Corrêa, P.S. Almeida, A.P. de Mattos, H.C. Ribeiro Jr, D.B. Pedral Sampaio)

Main Article

Table 2

Oligonucleotides used for detection and quantification of cosaviruses*

Oligonucleotide identity Sequence, 5′ → 3′ Genomic target region, RT-PCR type Use Reference
DKV-N5U-F1 CGTGCTTTACACGGTTTTTGA (+) 5’-UTR, nested RT-PCR 1st round Cosavirus detection† (3)
DKV-N5U-R2 GGTACCTTCAGGACATCTTTGG (–)
DKV-N5U-F2 ACGGTTTTTGAACCCCACAC (+) 5’-UTR, nested RT-PCR 2nd round
DKV-N5U-R3 GTCCTTTCGGACAGGGCTTT (–)
HCosV-rtF735-1 TTGTAGYGATGCTGTRTGTGTGTG (+) 5’-UTR, real time RT-PCR Brazilian cosavirus quantification† This study
HCosV-rtP783 FAM-AGCCTCACAGGCCRRAAGCCCTGTC-DDQ1 (+, Probe)
HCosV-rtR827-1 CCAYTGTGTGGGTCCTTTCG (–)

*RT-PCR, reverse transcription PCR; UTR, untranslated region; FAM, fluorescein; R, G/A; DDQ1, deep dark quencher 1; Y, C/T.
†RT-PCR reactions were carried out using the QIAGEN One-step RT-PCR kit as described by the manufacturer (QIAGEN, São Paulo, Brazil), 300 nmol/L of each primer, 200 nmol/L of the probe (real time RT-PCR assay), 1 μg bovine serum albumin, and 5 μL RNA extract. Second-round reactions used the Platinum Taq DNA Polymerase Kit as described by the manufacturer (Invitrogen, São Paulo, Brazil) with 2.5 mol/L MgCl and 1 µL of first-round PCR product. Real time RT-PCR amplification involved 55°C for 15 min, 95°C for 15 min, and 45 cycles of 95°C for 15 s and 58°C for 30 s (fluorescence measured).Nested RT-PCR involved 30 min at 50°C; 15 min at 95°C; 10 cycles of 20 s at 94°C, 30 s starting at 60°C with a decrease of 1°C per cycle, and 50 s at 72°C; and 40 cycles of 20 s at 95°C, 30 s at 54°C, and 50 s at 72°C; and a final elongation step of 5 min at 72°C. Second-round reactions used 3 min at 94°C and thermal cycling as for the first round.

Main Article

References
  1. Li  L, Victoria  J, Kapoor  A, Blinkova  O, Wang  C, Babrzadeh  F, A novel picornavirus associated with gastroenteritis. J Virol. 2009;83:12002–6. DOIPubMedGoogle Scholar
  2. Greninger  AL, Runckel  C, Chiu  CY, Haggerty  T, Parsonnet  J, Ganem  D, The complete genome of klassevirus—a novel picornavirus in pediatric stool. Virol J. 2009;6:82. DOIPubMedGoogle Scholar
  3. Kapoor  A, Victoria  J, Simmonds  P, Slikas  E, Chieochansin  T, Naeem  A, A highly prevalent and genetically diversified Picornaviridae genus in South Asian children. Proc Natl Acad Sci U S A. 2008;105:20482–7. DOIPubMedGoogle Scholar
  4. Blinkova  O, Rosario  K, Li  L, Kapoor  A, Slikas  B, Bernardin  F, Frequent detection of highly diverse variants of cardiovirus, cosavirus, bocavirus, and circovirus in sewage samples collected in the United States. J Clin Microbiol. 2009;47:3507–13. DOIPubMedGoogle Scholar
  5. Holtz  LR, Finkbeiner  SR, Kirkwood  CD, Wang  D. Identification of a novel picornavirus related to cosaviruses in a child with acute diarrhea. Virol J. 2008;5:159. DOIPubMedGoogle Scholar
  6. Dai  XQ, Hua  XG, Shan  TL, Delwart  E, Zhao  W. Human cosavirus infections in children in China. J Clin Virol. 2010;48:228–9. DOIPubMedGoogle Scholar
  7. Drexler  JF, Baumgarte  S, Luna  LK, Stöcker  A, Almeida  PS, Ribeiro  TC, Genomic features and evolutionary constraints in Saffold-like cardioviruses. J Gen Virol. 2010;91:1418–27. DOIPubMedGoogle Scholar
  8. Baumgarte  S, de Souza Luna  LK, Grywna  K, Panning  M, Drexler  JF, Karsten  C, Prevalence, types, and RNA concentrations of human parechoviruses, including a sixth parechovirus type, in stool samples from patients with acute enteritis. J Clin Microbiol. 2008;46:242–8. DOIPubMedGoogle Scholar
  9. Bishop  RF. Natural history of human rotavirus infection. Arch Virol Suppl. 1996;12:119–28.PubMedGoogle Scholar
  10. Drexler  JF, Luna  LK, Stocker  A, Almeida  PS, Ribeiro  TC, Petersen  N, Circulation of 3 lineages of a novel Saffold cardiovirus in humans. Emerg Infect Dis. 2008;14:1398–405. DOIPubMedGoogle Scholar
  11. Drexler  JF, Baumgarte  S, de Souza Luna  LK, Eschbach-Bludau  M, Lukashev  AN, Drosten  C. Aichi virus shedding in high concentrations in patients with acute diarrhea. Emerg Infect Dis. 2011;17:1544–8.PubMedGoogle Scholar
  12. Henke-Gendo  C, Harste  G, Juergens-Saathoff  B, Mattner  F, Deppe  H, Heim  A. New real-time PCR detects prolonged norovirus excretion in highly immunosuppressed patients and children. J Clin Microbiol. 2009;47:2855–62. DOIPubMedGoogle Scholar
  13. Anderson  EJ. Rotavirus vaccines: viral shedding and risk of transmission. Lancet Infect Dis. 2008;8:642–9. DOIPubMedGoogle Scholar
  14. Laassri  M, Lottenbach  K, Belshe  R, Wolff  M, Rennels  M, Plotkin  S, Effect of different vaccination schedules on excretion of oral poliovirus vaccine strains. J Infect Dis. 2005;192:2092–8. DOIPubMedGoogle Scholar
  15. Yotsuyanagi  H, Koike  K, Yasuda  K, Moriya  K, Shintani  Y, Fujie  H, Prolonged fecal excretion of hepatitis A virus in adult patients with hepatitis A as determined by polymerase chain reaction. Hepatology. 1996;24:10–3. DOIPubMedGoogle Scholar

Main Article

1These authors contributed equally to this article.

Page created: March 15, 2012
Page updated: March 15, 2012
Page reviewed: March 15, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external