Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 18, Number 4—April 2012

Letter

Rickettsia monacensis as Cause of Mediterranean Spotted Fever–like Illness, Italy

Giordano MadedduComments to Author , Fabiola Mancini, Antonello Caddeo, Alessandra Ciervo, Sergio Babudieri, Ivana Maida, Maria Laura Fiori, Giovanni Rezza, and Maria Stella Mura
Author affiliations: University of Sassari, Sassari, Italy (G. Madeddu, A. Caddeo, S. Babudieri, I. Maida, M.L. Fiori, M.S. Mura); Istituto Superiore di Sanità, Rome, Italy (F. Mancini, A. Ciervo, G. Rezza)

Main Article

Table

Selected inner primers used to amplify rickettsial gltA and ompA genes*

Rickettsial groups Gene Primer Nucleotide sequence, 5′ → 3′ Product size, bp Reference
Rickettsiae spotted fever group plus typhus group gtlA gltA–F TCGCAAATGTTCACGGTACTTT 74 (8)
gltA–R TCGTGCATTTCTTTCCATTGTG
Rickettsiae ompA ompA ompA–F ATGGCGAATATTTCTCCAAAA 632 (9)
ompA–R GTTCCGTTAATGGCAGCATCT

*gltA, citrate synthase; ompA, outer membrane protein A.

Main Article

References
  1. Ciceroni  L, Pinto  A, Ciarrocchi  S, Ciervo  A. Current knowledge of rickettsial diseases in Italy. Ann N Y Acad Sci. 2006;1078:143–9.DOIGoogle Scholar
  2. Márquez  FJ, Muniain  MA, Soriguer  RC, Izquierdo  G, Rodríguez-Bano  J, Borobio  MV. Genotypic identification of an undescribed spotted fever group rickettsia in Ixodes ricinus from southwestern Spain. Am J Trop Med Hyg. 1998;58:570–7.
  3. Beninati  T, Lo  N, Noda  H, Esposito  F, Rizzoli  A, Favia  G, First detection of spotted fever group rickettsiae in Ixodes ricinus from Italy. Emerg Infect Dis. 2002;8:983–6.
  4. Simser  JA, Palmer  AT, Fingerle  V, Wilske  B, Kurtti  TJ, Munderloh  UG. Rickettsia monacensis sp. nov., a spotted fever group Rickettsia, from ticks (Ixodes ricinus) collected in a European city park. Appl Environ Microbiol. 2002;68:4559–66.DOIGoogle Scholar
  5. Sréter-Lancz  Z, Sréter  T, Széll  Z, Egyed  L. Molecular evidence of Rickettsia helvetica and R. monacensis infections in Ixodes ricinus from Hungary. Ann Trop Med Parasitol. 2005;99:325–30.DOIGoogle Scholar
  6. Chmielewski  T, Podsiadly  E, Karbowiak  G, Tylewska-Wierzbanowska  S. Rickettsia spp. in ticks, Poland. Emerg Infect Dis. 2009;15:486–8.DOIGoogle Scholar
  7. Jado  I, Oteo  JA, Aldámiz  M, Gil  H, Escudero  R, Ibarra  V, Rickettsia monacensis and human disease, Spain. Emerg Infect Dis. 2007;13:1405–7.
  8. Paris  DH, Blacksell  SD, Stenos  J, Graves  SR, Unsworth  NB, Phetsouvanh  R, Real-time multiplex PCR assay for detection and differentiation of rickettsiae and orientiae. Trans R Soc Trop Med Hyg. 2008;102:186–93.DOIGoogle Scholar
  9. Zhang  L, Jin  J, Fu  X, Raoult  D, Fournier  PE. Genetic differentiation of Chinese isolates of Rickettsia sibirica by partial ompA gene sequencing and multispacer typing. J Clin Microbiol. 2006;44:2465–7.DOIGoogle Scholar
  10. Di Todaro  N, Piazza  C, Otranto  D, Giangaspero  A. Ticks infesting domestic animals in Italy: current acarological studies carried out in Sardinia and Basilicata regions. Parassitologia. 1999;41(Suppl 1):39–40.

Main Article

Page created: March 16, 2012
Page updated: March 16, 2012
Page reviewed: March 16, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external