Volume 18, Number 8—August 2012
Dispatch
New Variants of Porcine Epidemic Diarrhea Virus, China, 2011
Table 1
Primers used in study of PEDV, China, 2011*
| Primer name | Nucleotide sequence, 5′ → 3′ | Primer location† |
|---|---|---|
| PEDVS1F | GGTAAGTTGCTAGTGCGTAA | 20,570–20,589 |
| PEDVS1R | CAGGGTCATCACAATAAAGAA | 22,010–22,030 |
| PEDVS2F | TTTCTGGACCGTAGCATC | 21,939–21,956 |
| PEDVS2R | TCCTGAAGTGGGACATAG | 22,917–22,935 |
| PEDVS3F | GAGTTGCCTGGTTTCTTC | 22,816–22,833 |
| PEDVS3R | TATAATTGCGCCTCAAAG | 24,979–24,996 |
*PEDV, porcine epidemic diarrhea virus; F, forward; R, reverse.
†Numbers correspond to the nucleotide positions within the CV777 genome.
Page created: July 19, 2012
Page updated: July 19, 2012
Page reviewed: July 19, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.