Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 19, Number 4—April 2013
Research

Circovirus in Tissues of Dogs with Vasculitis and Hemorrhage

Linlin Li, Sabrina McGraw, Kevin Zhu, Christian M. Leutenegger, Stanley L. Marks, Steven Kubiski, Patricia Gaffney, Florante N. Dela Cruz Jr, Chunlin Wang, Eric Delwart, and Patricia A. PesaventoComments to Author 
Author affiliations: Blood Systems Research Institute, San Francisco, California, USA (L. Li, E. Delwart); University of California, San Francisco (L. Li, E. Delwart); University of California School of Veterinary Medicine, Davis, California, USA (S. McGraw, K. Zhu, S.L. Marks, S. Kubiski, P. Gaffney, F.N. Dela Cruz Jr, P.A. Pesavento); IDEXX Laboratories, West Sacramento, California, USA (C.M. Leutenegger); Stanford Genome Technology Center, Stanford, California, USA (C. Wang)

Main Article

Table

Oligonucleotide primer pairs and probe for DogCV sequences*

Region and amplicon Primers Sequences, 5�?��+'3�?�
Replicate gene, 66 bases DogCV-forward CTTGCGAGAGCTGCTCCTTATAT
DogCV-reverse CTCCACTTCCGTCTTCCAGTTC
DogCV-probe
 TCCGGAGATGACCACGCCCC
Capsid gene, 68 bases DogCV2-forward CTGTTGTGAAACTGAAAGAGACGAA
DogCV2-reverse TGACGTAGGTCTCCGGATACG
DogCV2 -probe AGCCTTGCCGCTGTCGCGTC

*DogCV, dog circovirus.

Main Article

Page created: March 13, 2013
Page updated: March 13, 2013
Page reviewed: March 13, 2013
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external