Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 20, Number 11—November 2014
Research

Spread of Streptococcus pneumoniae Serotype 8-ST63 Multidrug-Resistant Recombinant Clone, Spain

Carmen ArdanuyComments to Author , Adela G. de la Campa, Ernesto García, Asunción Fenoll, Laura Calatayud, Emilia Cercenado, Emilio Pérez-Trallero, Emilio Bouza, and Josefina Liñares
Author affiliations: Hospital Universitari de Bellvitge–Universitat de Barcelona–Fundació Privada Institut d'Investigació Biomèdica de Bellvitge, Barcelona, Spain (C. Ardanuy, L. Calatayud, J. Liñares); Centros de Investigación Biomédica en Red de Enfermedades Respiratorias, Madrid, Spain (C. Ardanuy, A.G. de la Campa, A. Fenoll, L. Calatayud, E. Cercenado, E. Pérez-Trallero, E. Bouza, E. García, J. Liñares); Instituto de Salud Carolos II, Madrid (A. G. de la Campa, A. Fenoll); Consejo Superior de Cientificas, Madrid (A.G. de la Campa, E. García); Hospital Gregorio Marañón–Universidad Complutense, Madrid (E. Cercenado, E. Bouza); Hospital Universitario Donostia, Donostia, Spain (E. Pérez-Trallero)

Main Article

Table

Primers used to map the putative recombination event upstream of the pbp2x gene of Streptococcus pneumoniae, Spain, 2004–2012*

Primer Sequence (5′→3′) Position†
F1 aaatccgaagaaggccaaat 278234—278253
R1 Gtacttgagattggcgtgtttg 278834—278813
F2 Tcaatgactgtgatgcctgtt 290699—290719
R2 Tgtcagacaaataggacaaggaga 291315—291292
F3 Gtcaatgacaccaacctcttg 282168—282188
R3 Gctatgagccattctagcaaaga 283037—283015
F4 Tgaatgtaaagacacacgaggaa 273278—273300
R4 Cagtgataacgaataccatacagaa 274128—274104
F5 Cagctctatgaacaccggact 289177—289197
R5 Ttcctagtcgtaaccatcatttca 289927—289904
F6 Ccttggatacgggtattcgtt 287148—287168
R6 Gcagtcgcttgaccttttct 287756—287737
F7 Gtggacaggaagcaaagctc 275192—275211
R7 Ggcagtcagatttgcagaca 276056—276037

*The penicillin-binding protein 2x gene (pbp2x) (SPG_0305) of S. pneumoniae G54 strain (serotype 19F-ST63; GenBank accession no. CP001015) is located between positions 292638 and 294890 of its genome. F, forward; R, reverse.
†Corresponding to the genome of the G54 strain.

Main Article

Page created: October 17, 2014
Page updated: October 17, 2014
Page reviewed: October 17, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external