Volume 20, Number 11—November 2014
Research
Spread of Streptococcus pneumoniae Serotype 8-ST63 Multidrug-Resistant Recombinant Clone, Spain
Table
Primers used to map the putative recombination event upstream of the pbp2x gene of Streptococcus pneumoniae, Spain, 2004–2012*
Primer | Sequence (5′→3′) | Position† |
---|---|---|
F1 | aaatccgaagaaggccaaat | 278234—278253 |
R1 | Gtacttgagattggcgtgtttg | 278834—278813 |
F2 | Tcaatgactgtgatgcctgtt | 290699—290719 |
R2 | Tgtcagacaaataggacaaggaga | 291315—291292 |
F3 | Gtcaatgacaccaacctcttg | 282168—282188 |
R3 | Gctatgagccattctagcaaaga | 283037—283015 |
F4 | Tgaatgtaaagacacacgaggaa | 273278—273300 |
R4 | Cagtgataacgaataccatacagaa | 274128—274104 |
F5 | Cagctctatgaacaccggact | 289177—289197 |
R5 | Ttcctagtcgtaaccatcatttca | 289927—289904 |
F6 | Ccttggatacgggtattcgtt | 287148—287168 |
R6 | Gcagtcgcttgaccttttct | 287756—287737 |
F7 | Gtggacaggaagcaaagctc | 275192—275211 |
R7 | Ggcagtcagatttgcagaca | 276056—276037 |
*The penicillin-binding protein 2x gene (pbp2x) (SPG_0305) of S. pneumoniae G54 strain (serotype 19F-ST63; GenBank accession no. CP001015) is located between positions 292638 and 294890 of its genome. F, forward; R, reverse.
†Corresponding to the genome of the G54 strain.
Page created: October 17, 2014
Page updated: October 17, 2014
Page reviewed: October 17, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.