Volume 20, Number 11—November 2014
Research
Spread of Streptococcus pneumoniae Serotype 8-ST63 Multidrug-Resistant Recombinant Clone, Spain
Table
Primers used to map the putative recombination event upstream of the pbp2x gene of Streptococcus pneumoniae, Spain, 2004–2012*
Primer | Sequence (5′→3′) | Position† |
---|---|---|
F1 | aaatccgaagaaggccaaat | 278234—278253 |
R1 | Gtacttgagattggcgtgtttg | 278834—278813 |
F2 | Tcaatgactgtgatgcctgtt | 290699—290719 |
R2 | Tgtcagacaaataggacaaggaga | 291315—291292 |
F3 | Gtcaatgacaccaacctcttg | 282168—282188 |
R3 | Gctatgagccattctagcaaaga | 283037—283015 |
F4 | Tgaatgtaaagacacacgaggaa | 273278—273300 |
R4 | Cagtgataacgaataccatacagaa | 274128—274104 |
F5 | Cagctctatgaacaccggact | 289177—289197 |
R5 | Ttcctagtcgtaaccatcatttca | 289927—289904 |
F6 | Ccttggatacgggtattcgtt | 287148—287168 |
R6 | Gcagtcgcttgaccttttct | 287756—287737 |
F7 | Gtggacaggaagcaaagctc | 275192—275211 |
R7 | Ggcagtcagatttgcagaca | 276056—276037 |
*The penicillin-binding protein 2x gene (pbp2x) (SPG_0305) of S. pneumoniae G54 strain (serotype 19F-ST63; GenBank accession no. CP001015) is located between positions 292638 and 294890 of its genome. F, forward; R, reverse.
†Corresponding to the genome of the G54 strain.