Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 20, Number 5—May 2014
Research

Molecular Characterization of Cryptically Circulating Rabies Virus from Ferret Badgers, Taiwan

Hue-Ying Chiou, Chia-Hung Hsieh, Chian-Ren Jeng, Fang-Tse Chan, Hurng-Yi Wang, and Victor Fei PangComments to Author 
Author affiliations: National Taiwan University, Taipei, Taiwan, Republic of China (H.-Y. Chiou, C.-H. Hsieh, C.-R. Jeng, H.-Y. Wang, V.F. Pang); Council of Agriculture, Executive Yuan, Nantou County, Taiwan, Republic of China (F.-T. Chan)

Main Article

Table 1

Primers used for the amplification and sequencing of rabies virus genome*

Primer Sequence, 5′→3′ Amplicon size, nt Position, nt
3′F GTACCTAGACGCTTAACAAC 499 1–499
3′R AAGACCGACTAAGGACGCAT
NF ATGTAACACCTCTACAATGG 1,533 55–1587
NR CAGTCTCYTCNGCCATCT
PF GAACCAYCCCAAAYATGAG 1,001 1500–2500
PR TTCATTTTRTYAGTGGTGTTGC
MF AAAAACRGGCAACACCACT 641 2479–3119
MR TCCTCYAGAGGTAWACAAGTG
G1F TGGTGTATAACATGRAYTC 1,097 3000–4096
G1R ACCCATGTYCCRTCATAAG
G2F TGGATTTGTGGATKAAAGAGGC 1,542 3995–5536
G2R GAGTTNAGRTTGTARTCAGAG
L1F TGGRGAGGTYTATGATGACCC 726 5430–6155
L1R CAGCATNAGTGTRTAGTTTCTGTC
L2F GGTCGATTATGATAAKGCATTTGG 704 5885–6588
L2R TTGACAGACCCTTTCGATAATC
L3F GGATCAATTCGACAACATACATG 550 6473–7024
L3R AAGTCTTCATCHGGCARTCCTCC
L4F AGACTAGCTTCHTGGYTGTCAG 708 6882–7589
L4R TACTTTGGTTCTTGTGTTCCTG
L5F AGTGTTTGGATTGAAGAGAGTGTT 662 7337–7998
L5R GAAAGACTGCCTGCACTGACAT
L6F AATAGTCAACCTCGCCAATATAATG 767 7897–8645
L6R GGATCTCTGAGTTGTAGAAGGATTC
L7F CCGAGTCAATCATTGGATTGATAC 621 8517–9137
L7R GAATACCCTCCTTCGCTGTATCTG
L8F GAGAAGGTCACCAATGTTGATG 1,045 8958–10002
L8R AGATCCAYARCCAGTCATTCTC
L9F ACATAATGCTCAGAGAACCGT 503 9820–10322
L9R CCATTCTGAACATCCTACCTT
L10F TGTTCAGAATGGGTCTGCTCT 509 10302–10811
L10R TGCATCGCAAATAATGAGGT
L11F ATTATTTGCGATGCAGAAGT 524 10797–11320
L11R ATGATAGCCACTTTAGACAGAGT
L12F GTTACAGAGGGGAACTCTGTCT 386 11285–11670
L12R TCTTCACTATCTTGTAAATCAACCT
5′F TGGATCAGGTTGATTTACAAGATAGT 293 11640–11932
5′R ACGCTTAACAAATAAACAACAAAAAT

*Primers were from Lei et al. (10).

Main Article

References
  1. Jackson  AC. Pathogenesis. In: Jackson AC, Wunner WH, editors. Rabies. London: Elsevier Academic Press; 2007.
  2. World Health Organization. WHO Expert Consultation on Rabies: second report. Geneva. Organization. 2013;•••:1139.
  3. Wandeler  A. Virus infections of non-domestic carnivores: rabies virus. In: Appel MJ, editor. Virus infections of carnivores. Amsterdam: Elsevier Science Publishers; 1987. p. 449–61.
  4. Barnard  BJH. The role played by wildlife in the epizootiology of rabies in South Africa and South-West Africa. Onderstepoort J Vet Res. 1979;46:15563 .PubMed
  5. Smith  GC, Wilkinson  D. Modelling disease spread in a novel host: rabies in the European badger Meles meles. J Appl Ecol. 2002;39:86574. DOI
  6. Wandeler  A, Wachendorfer  G, Forster  U, Krekel  H, Muller  J, Steck  F. Rabies in wild carnivores in central Europe. II. Virological and serological examinations. Zentralbl Veterinarmed B. 1974;21:75764 . DOIPubMed
  7. Liu  Y, Zhang  SF, Wu  XF, Zhao  JH, Hou  YL, Zhang  F, Ferret badger rabies origin and its revisited importance as potential source of rabies transmission in southeast China. BMC Infect Dis. 2010;10:234. DOIPubMed
  8. Zhenyu  G, Zhen  W, Enfu  C, Fan  H, Junfen  L, Yixin  L, Human rabies cluster following badger bites, People’s Republic of China. Emerg Infect Dis. 2007;13:19567. DOIPubMed
  9. Zhang  S, Tang  Q, Wu  XF, Liu  Y, Zhang  F, Rupprecht  CE, Rabies in ferret badgers, southeastern China. Emerg Infect Dis. 2009;15:9469 . DOIPubMed
  10. Lei  YL, Wang  XG, Liu  FM, Chen  XY, Ye  BF, Mei  JH, Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese ferret-badger) in Zhejiang Province [in Chinese]. Zhonghua Liu Xing Bing Xue Za Zhi. 2009;30:8248 .PubMed
  11. Thompson  JD, Higgins  DG, Gibson  TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:467380. DOIPubMed
  12. Tamura  K, Peterson  D, Peterson  N, Stecher  G, Nei  M, Kumar  S. MEGA5: Molecular Evolutionary Genetics Analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:27319. DOIPubMed
  13. Librado  P, Rozas  J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009;25:14512. DOIPubMed
  14. Tajima  F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics. 1989;123:58595 .PubMed
  15. Fu  YX, Li  WH. Statistical tests of neutrality of mutations. Genetics. 1993;133:693709 .PubMed
  16. He  CQ, Meng  SL, Yan  HY, Ding  NZ, He  HB, Yan  JX, Isolation and identification of a novel rabies virus lineage in China with natural recombinant nucleoprotein gene. PLoS ONE. 2012;7:e49992. DOIPubMed
  17. Bourhy  H, Reynes  JM, Dunham  EJ, Dacheux  L, Larrous  F, Huong  VT, The origin and phylogeography of dog rabies virus. J Gen Virol. 2008;89:267381. DOIPubMed
  18. Guindon  S, Gascuel  O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol. 2003;52:696704. DOIPubMed
  19. Posada  D. jModelTest: phylogenetic model averaging. Mol Biol Evol. 2008;25:12536. DOIPubMed
  20. Ronquist  F, Huelsenbeck  JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:15724. DOIPubMed
  21. Drummond  AJ, Suchard  MA, Xie  D, Rambaut  A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol Biol Evol. 2012;29:196973. DOIPubMed
  22. Drummond  AJ, Ho  SY, Phillips  MJ, Rambaut  A. Relaxed phylogenetics and dating with confidence. PLoS Biol. 2006;4:e88. DOIPubMed
  23. Meng  S, Sun  Y, Wu  X, Tang  J, Xu  G, Lei  Y, Evolutionary dynamics of rabies viruses highlights the importance of China rabies transmission in Asia. Virology. 2011;410:4039. DOIPubMed
  24. Kissi  B, Tordo  N, Bourhy  H. Genetic polymorphism in the rabies virus nucleoprotein gene. Virology. 1995;209:52637. DOIPubMed
  25. Mebatsion  T, Weiland  F, Conzelmann  KK. Matrix protein of rabies virus is responsible for the assembly and budding of bullet-shaped particles and interacts with the transmembrane spike glycoprotein G. J Virol. 1999;73:24250 .PubMed
  26. Finke  S, Mueller-Waldeck  R, Conzelmann  KK. Rabies virus matrix protein regulates the balance of virus transcription and replication. J Gen Virol. 2003;84:161321. DOIPubMed
  27. Kassis  R, Larrous  F, Estaquier  J, Bourhy  H. Lyssavirus matrix protein induces apoptosis by a TRAIL-dependent mechanism involving caspase-8 activation. J Virol. 2004;78:654355. DOIPubMed
  28. Lentz  TL, Wilson  PT, Hawrot  E, Speicher  DW. Amino acid sequence similarity between rabies virus glycoprotein and snake venom curaremimetic neurotoxins. Science. 1984;226:8478. DOIPubMed
  29. Poch  O, Blumberg  BM, Bougueleret  L, Tordo  N. Sequence comparison of five polymerases (L proteins) of unsegmented negative-strand RNA viruses: theoretical assignment of functional domains. J Gen Virol. 1990;71:115362. DOIPubMed
  30. Kuzmin  IV, Wu  X, Tordo  N, Rupprecht  CE. Complete genomes of Aravan, Khujand, Irkut and West Caucasian bat viruses, with special attention to the polymerase gene and non-coding regions. Virus Res. 2008;136:8190. DOIPubMed
  31. Zhang  S, Zhao  J, Liu  Y, Fooks  AR, Zhang  F, Hu  R. Characterization of a rabies virus isolate from a ferret badger (Melogale moschata) with unique molecular differences in glycoprotein antigenic site III. Virus Res. 2010;149:14351. DOIPubMed
  32. Gong  W, Jiang  Y, Za  Y, Zeng  Z, Shao  M, Fan  J, Temporal and spatial dynamics of rabies viruses in China and Southeast Asia. Virus Res. 2010;150:1118. DOIPubMed
  33. Saito  M, Oshitani  H, Orbina  JR, Tohma  K, de Guzman  AS, Kamigaki  T, Genetic diversity and geographic distribution of genetically distinct rabies viruses in the Philippines. PLoS Negl Trop Dis. 2013;7:e2144. DOIPubMed
  34. Streicker  DG, Lemey  P, Velasco-Villa  A, Rupprecht  CE. Rates of viral evolution are linked to host geography in bat rabies. PLoS Pathog. 2012;8:e1002720. DOIPubMed
  35. Biek  R, Henderson  JC, Waller  LA, Rupprecht  CE, Real  LA. A high-resolution genetic signature of demographic and spatial expansion in epizootic rabies virus. Proc Natl Acad Sci U S A. 2007;104:79938. DOIPubMed
  36. Faber  M, Faber  ML, Papaneri  A, Bette  M, Weihe  E, Dietzschold  B, A single amino acid change in rabies virus glycoprotein increases virus spread and enhances virus pathogenicity. J Virol. 2005;79:141418. DOIPubMed
  37. Faber  M, Li  J, Kean  RB, Hooper  DC, Alugupalli  KR, Dietzschold  B. Effective preexposure and postexposure prophylaxis of rabies with a highly attenuated recombinant rabies virus. Proc Natl Acad Sci U S A. 2009;106:113005. DOIPubMed
  38. Lafon  M. Rabies virus receptors. J Neurovirol. 2005;11:827. DOIPubMed
  39. Tuffereau  C, Schmidt  K, Langevin  C, Lafay  F, Dechant  G, Koltzenburg  M. The rabies virus glycoprotein receptor p75NTR is not essential for rabies virus infection. J Virol. 2007;81:1362230. DOIPubMed
  40. Kuzmin  IV, Shi  M, Orciari  LA, Yager  PA, Velasco-Villa  A, Kuzmina  NA, Molecular inferences suggest multiple host shifts of rabies viruses from bats to mesocarnivores in Arizona during 2001–2009. PLoS Pathog. 2012;8:e1002786 . DOIPubMed

Main Article

1Joint senior authors who contributed equally to this article.

Page created: April 16, 2014
Page updated: April 16, 2014
Page reviewed: April 16, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external