Volume 21, Number 3—March 2015
Letter
Rickettsia rickettsii in Amblyomma patinoi Ticks, Colombia
Álvaro A. Faccini-Martínez, Francisco B. Costa, Tatiana E. Hayama-Ueno, Alejandro Ramírez-Hernández, Jesús A. Cortés-Vecino, Marcelo B. Labruna, and Marylin Hidalgo
Table
Primer pairs used for amplification of rickettsial genes or intergenic regions, Colombia, August 2013
| Target, primer pairs, primers | Primer sequences, 5′ → 3′ | Fragment size, bp | Reference |
|---|---|---|---|
| gltA | |||
| 1 | |||
| CS-78 | GCAAGTATCGGTGAGGATGTAAT | 401 | (6) |
| CS-323 | GCTTCCTTAAAATTCAATAAATCAGGAT | (6) | |
| 2 | |||
| CS-239 | GCTCTTCTCATCCTATGGCTATTAT | 834 | (6) |
| CS-1069 |
CAGGGTCTTCGTGCATTTCTT |
(6) |
|
| ompA | |||
| 3 | |||
| Rr190.70p | ATGGCGAATATTTCTCCAAAA | 530 | (7) |
| Rr190.602n |
AGTGCAGCATTCGCTCCCCCT |
(7) |
|
| ompB | |||
| 4 | |||
| 120-M59 | CCGCAGGGTTGGTAACTGC | 862 | (8) |
| 120–807 |
CCTTTTAGATTACCGCCTAA |
(8) |
|
| RR0155-rpmB | |||
| 5 | |||
| Forward | TTTCTAGCAGCGGTTGTTTTATCC | 290 | (9) |
| Reverse |
TTAGCCCATGTTGACAGGTTTACT |
(9) |
|
| RR1240-tlc5b | |||
| 6 | |||
| Forward | CGGGATAACGCCGAGTAATA | 357 | (10) |
| Reverse |
ATGCCGCTCTGAATTTGTTT |
(10) |
|
| cspA-ksgA | |||
| 7 | |||
| Forward | CATCACTGCTTCGCTTATTTT | 405 | (9) |
| Reverse | ATTTCTTTTCTTCCTCTTCATCAA | (9) |
References
- Hidalgo M, Orejuela L, Fuya P, Carrillo P, Hernández J, Parra E, Rocky Mountain spotted fever, Colombia. Emerg Infect Dis. 2007;13:1058–60. DOIPubMedGoogle Scholar
- Krawczak FS, Nieri-Bastos FA, Nunes FP, Soares JF, Moraes-Filho J, Labruna MB. Rickettsial infection in Amblyomma cajennense ticks and capybaras (Hydrochoerus hydrochaeris) in a Brazilian spotted fever–endemic area. Parasit Vectors. 2014;7:7.
- Patiño L, Afanador A, Paul JH. A spotted fever in Tobia, Colombia. Am J Trop Med. 1937;17:639–53.
- Patiño-Camargo L. Nuevas observaciones sobre un tercer foco de fiebre petequial (maculosa) en el hemisferio Americano. Bol De la Ofic Sanit Panamericana. 1941;20:1112–24.
- Nava S, Beati L, Labruna MB, Caceres AG, Mangold AJ, Guglielmone AA. Reassessment of the taxonomic status of Amblyomma cajennense (Fabricius, 1787) with the description of three new species, Amblyomma tonelliae n. sp., Amblyomma interandinum n. sp. and Amblyomma patinoi n. sp., and resurrection of Amblyomma mixtum Koch, 1844 and Amblyomma sculptum Berlese, 1888 (Ixodida: Ixodidae). Ticks Tick Borne Dis. 2014;5:252–76.
- Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol. 2004;42:90–8. DOIPubMedGoogle Scholar
- Eremeeva M, Yu X, Raoult D. Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA. J Clin Microbiol. 1994;32:803–10 .PubMedGoogle Scholar
- Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000;50:1449–55. DOIPubMedGoogle Scholar
- Karpathy SE, Dasch GA, Eremeeva ME. Molecular typing of isolates of Rickettsia rickettsii by use of DNA sequencing of variable intergenic regions. J Clin Microbiol. 2007;45:2545–53. DOIPubMedGoogle Scholar
- Fournier PE, Zhu Y, Ogata H, Raoult D. Use of highly variable intergenic spacer sequences for multispacer typing of Rickettsia conorii strains. J Clin Microbiol. 2004;42:5757–66. DOIPubMedGoogle Scholar
Page created: February 18, 2015
Page updated: February 18, 2015
Page reviewed: February 18, 2015
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.