Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 21, Number 3—March 2015
Letter

Rickettsia rickettsii in Amblyomma patinoi Ticks, Colombia

Álvaro A. Faccini-Martínez, Francisco B. Costa, Tatiana E. Hayama-Ueno, Alejandro Ramírez-Hernández, Jesús A. Cortés-Vecino, Marcelo B. Labruna, and Marylin HidalgoComments to Author 
Author affiliations: Pontificia Universidad Javeriana, Bogotá, Colombia (Á.A. Faccini-Martínéz, M. Hidalgo); Universidade de São Paulo, São Paulo, Brazil (F.B. Costa, T.E. Hayama-Ueno, M.B. Labruna); Universidad Nacional de Colombia, Bogotá (A. Ramírez-Hernández, J.A. Cortés-Vecino)

Main Article

Table

Primer pairs used for amplification of rickettsial genes or intergenic regions, Colombia, August 2013

Target, primer pairs, primers Primer sequences, 5′ → 3′ Fragment size, bp Reference
gltA
1
CS-78 GCAAGTATCGGTGAGGATGTAAT 401 (6)
CS-323 GCTTCCTTAAAATTCAATAAATCAGGAT (6)
2
CS-239 GCTCTTCTCATCCTATGGCTATTAT 834 (6)
CS-1069
CAGGGTCTTCGTGCATTTCTT

(6)
ompA
3
Rr190.70p ATGGCGAATATTTCTCCAAAA 530 (7)
Rr190.602n
AGTGCAGCATTCGCTCCCCCT

(7)
ompB
4
120-M59 CCGCAGGGTTGGTAACTGC 862 (8)
120–807
CCTTTTAGATTACCGCCTAA

(8)
RR0155-rpmB
5
Forward TTTCTAGCAGCGGTTGTTTTATCC 290 (9)
Reverse
TTAGCCCATGTTGACAGGTTTACT

(9)
RR1240-tlc5b
6
Forward CGGGATAACGCCGAGTAATA 357 (10)
Reverse
ATGCCGCTCTGAATTTGTTT

(10)
cspA-ksgA
7
Forward CATCACTGCTTCGCTTATTTT 405 (9)
Reverse ATTTCTTTTCTTCCTCTTCATCAA (9)

Main Article

References
  1. Hidalgo  M, Orejuela  L, Fuya  P, Carrillo  P, Hernández  J, Parra  E, Rocky Mountain spotted fever, Colombia. Emerg Infect Dis. 2007;13:105860. DOIPubMed
  2. Krawczak  FS, Nieri-Bastos  FA, Nunes  FP, Soares  JF, Moraes-Filho  J, Labruna  MB. Rickettsial infection in Amblyomma cajennense ticks and capybaras (Hydrochoerus hydrochaeris) in a Brazilian spotted fever–endemic area. Parasit Vectors. 2014;7:7.
  3. Patiño  L, Afanador  A, Paul  JH. A spotted fever in Tobia, Colombia. Am J Trop Med. 1937;17:63953.
  4. Patiño-Camargo  L. Nuevas observaciones sobre un tercer foco de fiebre petequial (maculosa) en el hemisferio Americano. Bol De la Ofic Sanit Panamericana. 1941;20:111224.
  5. Nava  S, Beati  L, Labruna  MB, Caceres  AG, Mangold  AJ, Guglielmone  AA. Reassessment of the taxonomic status of Amblyomma cajennense (Fabricius, 1787) with the description of three new species, Amblyomma tonelliae n. sp., Amblyomma interandinum n. sp. and Amblyomma patinoi n. sp., and resurrection of Amblyomma mixtum Koch, 1844 and Amblyomma sculptum Berlese, 1888 (Ixodida: Ixodidae). Ticks Tick Borne Dis. 2014;5:252–76.
  6. Labruna  MB, Whitworth  T, Horta  MC, Bouyer  DH, McBride  JW, Pinter  A, Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol. 2004;42:908. DOIPubMed
  7. Eremeeva  M, Yu  X, Raoult  D. Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA. J Clin Microbiol. 1994;32:80310 .PubMed
  8. Roux  V, Raoult  D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000;50:144955. DOIPubMed
  9. Karpathy  SE, Dasch  GA, Eremeeva  ME. Molecular typing of isolates of Rickettsia rickettsii by use of DNA sequencing of variable intergenic regions. J Clin Microbiol. 2007;45:254553. DOIPubMed
  10. Fournier  PE, Zhu  Y, Ogata  H, Raoult  D. Use of highly variable intergenic spacer sequences for multispacer typing of Rickettsia conorii strains. J Clin Microbiol. 2004;42:575766. DOIPubMed

Main Article

Page created: February 18, 2015
Page updated: February 18, 2015
Page reviewed: February 18, 2015
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external