Volume 22, Number 2—February 2016
Dispatch
Mediterranean Fin Whales (Balaenoptera physalus) Threatened by Dolphin MorbilliVirus
Table 2
Primer | Nucleotide position | Sense sequence, 5′ → 3′ | Fragment length, bp | |
---|---|---|---|---|
DMV-10F | 7206–7226 | GGGTGTGCTAGCCGTTATGT | 718 | |
DMV-10R | 7904–7924 | TTCGTCCTCATCAATCACCA | 718 | |
DMV 11F | 7799–7891 | CCGAACCTGATGATCCATTT | 612 | |
DMV-11R | 8391–8411 | CGTAAATGTCCATCCCTGCT | 612 | |
DMV-12F | 8290–8309 | AACCGGATCCCAGCTTATG | 800 | |
DMV-12R | 9070–9090 | CCAGGTGCACTTCAGGGTAT | 800 |
*Isolate GenBank accession no. AJ608288. Annealing temperature for all primers was 56°C. DMV, dolphin morbillivirus; F, forward; R, reverse.
Page created: January 15, 2016
Page updated: January 15, 2016
Page reviewed: January 15, 2016
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.