Volume 22, Number 3—March 2016
Research
Underestimation of Invasive Meningococcal Disease in Italy
Table 1
Target |
Gene |
Forward primer |
Reverse primer |
Probe |
---|---|---|---|---|
N. meningitidis | ctrA | gctgcggtaggtggttcaa | ttgtcgcggatttgcaacta | FAM_cattgccacgtgtcagctgcacat_TAMRA |
Serogroup A | sacB | cccccagcatggctagattt | agggcactttgtggcataattt | FAM_accctaaaattcaatgggtatatcacga_TAMRA |
Serogroup B | siaD B | ttggacttggttaagctgacctaa | gttgacaacatctccattttatcttacc | FAM_ttagatatgacaaataaattgttacgtggg_TAMRA |
Serogroup C | siaD C | agggaaccgcaacctatgc | cacaaaacgttgctcaaattttg | FAM_ccactcttagaatcatttacatacaaaccc_TAMRA |
Serogroup W/Y | siaD W/Y | gctgataaattgttcttatggtctgaa | cggcaccagaaccaatctct | FAM_ttggaatcatgagcttttaccaaatccaaca_TAMRA |
Serogroup W* | siaD | cagaagtgagggatttccata | cacaaccattttcattatagttactgt | |
Serogroup Y* | siaD | ctcaaagcgaaggctttggtta | ctgaagcgttttcattataattgctaa | |
*Identified by using endpoint PCR.
1These authors contributed equally to this article.
Page created: February 18, 2016
Page updated: February 18, 2016
Page reviewed: February 18, 2016
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.