Volume 22, Number 5—May 2016
CME ACTIVITY - Research
Spectrum of Viral Pathogens in Blood of Malaria-Free Ill Travelers Returning to Canada
Table 2
Primer and probe | Sequence, 5′→ 3′ | Concentration, nmol/L | Reference |
---|---|---|---|
Pandengue-MS2 | (23,24) | ||
Den Eili fwd primer | GGACTAGAGGTTAGAGGAGACCCC | 500 | |
Den Eili rev primer | GAGACAGCAGGATCTCTGGTC | 500 | |
Den Eili probe | FAM-AGCATATTGACGCTGGGA-MGB-BHQ1 | 125 | |
MS2-TM2 fwd primer | TGCTCGCGGATACCCG | 500 | |
MS2-TM2 rev primer | AACTTGCGTTCTCGAGCGAT | 500 | |
MS2-TM2 probe |
Quasar670-ACCTCGGGTTTCCGTCTTGCTCGT-BHQ1 |
125 |
|
Dengue virus serotyping | (25) | ||
DENV-1 fwd primer | CAAAAGGAAGTCGTGCAATA | 500 | |
DENV-1 rev primer | CTGAGTGAATTCTCTCTACTGAACC | 500 | |
DENV-1 probe | FAM-CATGTGGTTGGGAGCACGC-BHQ1 | 125 | |
DENV-2 fwd primer | CAGGTTATGGCACTGTCACGAT | 500 | |
DENV-2 rev primre | CCATCTGCAGCAACACCATCTC | 500 | |
DENV-2 probe | HEX-CTCTCCGAGAACAGGCCTCGACTTCAA-BHQ-1 | 125 | |
DENV-3 fwd primer | GGACTGGACACACGCACTCA | 500 | |
DENV-3 rev primer | CATGTCTCTACCTTCTCGACTTGTCT | 500 | |
DENV-3 probe | FAM-ACCTGGATGTCGGCTGAAGGAGCTTG-BHQ1 | 125 | |
DENV-4 fwd primer | TTGTCCTAATGATGCTGGTCG | 500 | |
DENV-4 rev primer | TCCACCTGAGACTCCTTCCA | 500 | |
DENV-4 probe |
HEX-TTCCTACTCCTACGCATCGCATTCCG-BHQ1 |
125 |
|
Panflavivirus | (26) | ||
Flavi all S (sense) | TACAACATgATggggAARAgAgARAA | 500 | |
Flavi all AS2 (antisense) | gTgTCCCAgCCNgCKgTgTCATCWgC | 500 | |
DENV-4F | TACAACATgATgggRAAACgTgAGAA | 500 | |
Flavi all probe 1 | FAM-AARggHAgYMgNgCCA+TH+T+g+g+T-BBQ† | 100 | |
Flavi probe 3a | FAM-CCgTgCCATATggTATATgTggCTgggAgC-BBQ† | 100 | |
Flavi probe 3b |
FAM-TTTCTggAATTTgAAgCCCTgggTTT-BBQc |
100 |
|
Hepatitis A virus | (27); vital SOP‡ | ||
HAV 68 | TCACCGCCGTTTGCC | 500 | |
HAV240 | GGAGAGCCCTGGAAGAAAG | 500 | |
HAV150 probe |
FAM-CCTGAACCTGCAGGAATTAA-MGB-NFQ |
125 |
|
Chikungunya virus | (28) | ||
ChikF10378–10398 | GCATCAGCTAAGCTCCGGGTC | 500 | |
ChikR 10487–10508¶ | GGTGTCCAGGCTGAAGACATTG | 500 | |
Chik Pongsiri | HEX-ATGCAAACGGCGACCATGCCGTCA-VIC | 125 |
*The primers and probes were used with the Applied Biosystems 7500 Fast Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). fwd, forward; rev, reverse; SOP, standard operating procedure.
†Locked nucleic acid bases.
‡Vital Standard Operating Procedure modified from Costafreda et al. (27).
¶ChikR10487-10508 reverse complement used from published sequence.
References
- Antinori S, Galimberti L, Gianelli E, Calattini S, Piazza M, Morelli P, Prospective observational study of fever in hospitalized returning travelers and migrants from tropical areas, 1997–2001. J Travel Med. 2004;11:135–42 . DOIPubMedGoogle Scholar
- Committee to Advise on Tropical Medicine and Travel (CATMAT). Fever in the returning international traveller: initial assessment guidelines. Can Commun Dis Rep. 2011;37:1–15.
- Bottieau E, Clerinx J, Schrooten W, Van den Enden E, Wouters R, Van Esbroeck M, Etiology and outcome of fever after a stay in the tropics. Arch Intern Med. 2006;166:1642–8. DOIPubMedGoogle Scholar
- O’Brien D, Tobin S, Brown GV, Torresi J. Fever in returned travelers: review of hospital admissions for a 3-year period. Clin Infect Dis. 2001;33:603–9. DOIPubMedGoogle Scholar
- West NS, Riordan FA. Fever in returned travellers: a prospective review of hospital admissions for a 2(1/2) year period. Arch Dis Child. 2003;88:432–4 . DOIPubMedGoogle Scholar
- Freedman DO, Weld LH, Kozarsky PE, Fisk T, Robins R, von Sonnenburg F, GeoSentinel Surveillance Network. Spectrum of disease and relation to place of exposure among ill returned travelers. N Engl J Med. 2006;354:119–30. DOIPubMedGoogle Scholar
- Centers for Disease Control and Prevention. Summary of notifiable diseases—United States, 2013. MMWR Morb Mortal Wkly Rep. 2014;63:702–15 .PubMedGoogle Scholar
- Public Health Agency of Canada. Notifiable disease on-line: salmonellosis. 2013 [cited 2015 Jul 12]. http://dsol-smed.phac-aspc.gc.ca/dsol-smed/ndis/charts.php?c=yl
- Ontario Agency for Health Protection and Promotion (Public Health Ontario). Reportable disease trends in Ontario, 2011. Toronto: Queen’s Printer for Ontario; 2014 [cited 2015 Jul 12]. http://www.publichealthontario.ca/en/eRepository/Reportable_Disease_Trends_in_Ontario_2011.pdf
- Public Health Agency of Canada. Measles: global update: travel health notice. July 16, 2015 [cited 2015 May 31]. http://www.phac-aspc.gc.ca/tmp-pmv/notices-avis/notices-avis-eng.php?id=98
- Drebot MA, Holloway K, Zheng H, Ogden NH. Travel-related chikungunya cases in Canada, 2014. Can Commun Dis Rep. 2015;41:2–5.
- Boggild AK, Geduld J, Libman M, Ward BJ, McCarthy AE, Doyle PW, Travel-acquired infections and illnesses in Canadians: surveillance report from CanTravNet surveillance data, 2009–2011. Open Med. 2014;8:e20–32.
- Boggild AK, Geduld J, Libman M, McCarthy A, Vincelette J, Ghesquiere W, Travel acquired infections in Canada: CanTravNet 2011–2012. Can Commun Dis Rep. 2014;40:313–25.
- Khan K, Bogoch I, Brownstein JS, Miniota J, Nicolucci A, Hu W, Assessing the origin of and potential for international spread of chikungunya virus from the Caribbean. PLoS Curr. 2014;6:6:pii:ecurrents.outbreaks.2134a0a7bf37fd8d388181539fea2da5.
- Boggild AK, Esposito DH, Kozarsky PE, Ansdell V, Beeching NJ, Campion D, GeoSentinel Surveillance Network. Differential diagnosis of illness in travelers arriving from Sierra Leone, Liberia, or Guinea: a cross-sectional study from the GeoSentinel Surveillance Network. Ann Intern Med. 2015;162:757–64. DOIPubMedGoogle Scholar
- Jazuli F, Klowak M, Boggild AK. Implementation and evaluation of a rapid assessment clinic for febrile returned travelers in ambulatory tropical medicine. In: Abstracts of the 14th Conference of the International Society of Travel Medicine (CISTM14); Quebec City, QC, Canada; 2015 May 24–28. Abstract PO13.03. Atlanta: International Society of Travel Medicine; 2015.
- Leder K, Torresi J, Libman MD, Cramer JP, Castelli F, Schlagenhauf P, GeoSentinel Surveillance Network. GeoSentinel surveillance of illness in returned travelers, 2007–2011. Ann Intern Med. 2013;158:456–68. DOIPubMedGoogle Scholar
- Wilson ME, Weld LH, Boggild A, Keystone JS, Kain KC, von Sonnenburg F, GeoSentinel Surveillance Network. Fever in returned travelers: results from the GeoSentinel Surveillance Network. Clin Infect Dis. 2007;44:1560–8. DOIPubMedGoogle Scholar
- Phuong M, Lau R, Ralevski F, Boggild AK. Sequence-based optimization of a quantitative real-time PCR assay for detection of Plasmodium ovale and Plasmodium malariae. J Clin Microbiol. 2014;52:1068–73. DOIPubMedGoogle Scholar
- Khairnar K, Martin D, Lau R, Ralevski F, Pillai DR. Multiplex real-time quantitative PCR, microscopy and rapid diagnostic immuno-chromatographic tests for the detection of Plasmodium spp: performance, limit of detection analysis and quality assurance. Malar J. 2009;8:284. DOIPubMedGoogle Scholar
- Corey L, Huang ML, Selke S, Wald A. Differentiation of herpes simplex virus types 1 and 2 in clinical samples by a real-time TaqMan PCR assay. J Med Virol. 2005;76:350–5. DOIPubMedGoogle Scholar
- Wada K, Kubota N, Ito Y, Yagasaki H, Kato K, Yoshikawa T, Simultaneous quantification of Epstein-Barr virus, cytomegalovirus, and human herpesvirus 6 DNA in samples from transplant recipients by multiplex real-time PCR assay. J Clin Microbiol. 2007;45:1426–32. DOIPubMedGoogle Scholar
- Huhtamo E, Hasu E, Uzcátegui NY, Erra E, Nikkari S, Kantele A, Early diagnosis of dengue in travelers: comparison of a novel real-time RT-PCR, NS1 antigen detection and serology. J Clin Virol. 2010;47:49–53. DOIPubMedGoogle Scholar
- Dreier J, Störmer M, Kleesiek K. Use of bacteriophage MS2 as an internal control in viral reverse transcription–PCR assays. J Clin Microbiol. 2005;43:4551–7. DOIPubMedGoogle Scholar
- Johnson BW, Russell BJ, Lanciotti RS. Serotype-specific detection of dengue viruses in a fourplex real-time reverse transcriptase PCR assay. J Clin Microbiol. 2005;43:4977–83. DOIPubMedGoogle Scholar
- Patel P, Landt O, Kaiser M, Faye O, Koppe T, Lass U, Development of one-step quantitative reverse transcription PCR for the rapid detection of flaviviruses. Virol J. 2013;10:58. DOIPubMedGoogle Scholar
- Costafreda MI, Bosch A, Pintó RM. Development, evaluation, and standardization of a real-time TaqMan reverse transcription-PCR assay for quantification of hepatitis A virus in clinical and shellfish samples. Appl Environ Microbiol. 2006;72:3846–55. DOIPubMedGoogle Scholar
- Pongsiri P, Praianantathavorn K, Theamboonlers A, Payungporn S, Poovorawan Y. Multiplex real-time RT-PCR for detecting chikungunya virus and dengue virus. Asian Pac J Trop Med. 2012;5:342–6.
- Gunson RN, Maclean AR, Shepherd SJ, Carman WF. Simultaneous detection and quantitation of cytomegalovirus, Epstein-Barr virus, and adenovirus by use of real-time PCR and pooled standards. J Clin Microbiol. 2009;47:765–70. DOIPubMedGoogle Scholar
- Gilden DH, Mahalingam R, Cohrs RJ, Tyler KL. Herpesvirus infections of the nervous system. Nat Clin Pract Neurol. 2007;3:82–94. DOIPubMedGoogle Scholar
- Houghton-Triviño N, Montaña D, Castellanos J. Dengue-yellow fever sera cross-reactivity; challenges for diagnosis. Rev Salud Publica (Bogota). 2008;10:299–307. DOIPubMedGoogle Scholar
- Askling HH, Rombo L, Andersson Y, Martin S, Ekdahl K. Hepatitis A risk in travelers. J Travel Med. 2009;16:233–8. DOIPubMedGoogle Scholar
Page created: April 02, 2018
Page updated: April 02, 2018
Page reviewed: April 02, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.