Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 24, Number 4—April 2018

Research

Avirulent Bacillus anthracis Strain with Molecular Assay Targets as Surrogate for Irradiation-Inactivated Virulent Spores

Roger D. Plaut, Andrea B. Staab, Mark A. Munson, Joan S. Gebhardt, Christopher P. Klimko, Avery V. Quirk, Christopher K. Cote, Tony L. Buhr, Rebecca D. Rossmaier, Robert C. Bernhards, Courtney E. Love, Kimberly L. Berk, Teresa G. Abshire, David A. Rozak, Linda C. Beck, Scott Stibitz, Bruce G. Goodwin, Michael A. Smith, and Shanmuga SozhamannanComments to Author 
Author affiliations: Food and Drug Administration, Silver Spring, Maryland, USA (R.D. Plaut, S. Stibitz); Naval Surface Warfare Center, Dahlgren, Virginia, USA (A.B. Staab, T.L. Buhr, L.C. Beck); Naval Medical Research Center, Fort Detrick, Maryland, USA (M.A. Munson, J.S. Gebhardt); US Army Medical Research Institute of Infectious Diseases, Fort Detrick (C.P. Klimko, A.V. Quirk, C.K. Cote, T.G. Abshire, D.A. Rozak); US Army Edgewood Chemical and Biological Center, Aberdeen Proving Ground, Maryland, USA (R.D. Rossmaier, R.C. Bernhards, C.E. Love, K.L. Berk); Defense Threat Reduction Agency, Fort Belvoir, Virginia, USA (R.C. Bernhards); Joint Research and Development, Inc., Stafford, Virginia, USA (C.E. Love, L.C. Beck); Defense Biological Product Assurance Office, Frederick, Maryland, USA (B.G. Goodwin, M.A. Smith, S. Sozhamannan); The Tauri Group, Inc., Alexandria, Virginia, USA (S. Sozhamannan)

Main Article

Table 1

Genotypic characteristics of Escherichia coli and Bacillus anthracis strains and plasmids and primers used to determine avirulent B. anthracis strain with molecular assay targets

Strain, plasmid, primer
Genotype
Reference/source
Strain
DH5α F− Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17(rk−, mk+) phoA supE44 thi-1 gyrA96 relA1 λ− Laboratory collection
SCS110 rpsL thr leu endA thi-1 lacY galK galT ara tonA tsx dam dcm supE44 Δ(lac-proAB) Stratagene (La Jolla, CA, USA)
SM10 thi thr leu tonA lacY supE recA::RP4–2-Tc::Mu KmR λpir (9)
S17.1 hsdR pro recA, RP4–2 in chromosome, Km::Tn7 (Tc::Mu) (9)
DH5α/pSS1827 F− Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17(rk−, mk+) phoA supE44 thi-1 gyrA96 relA1 λ−, pSS1827 (Replicon fusion of pBR322 and pRK2013 at EcoRI and SalI sites) (10)
BA500 B. anthracis Sterne 34F2 Laboratory collection
BAP482 BA500 Δcya and Δlef (double toxin deletion) (11)
BAP417 BA500 Δcya, Δlef, and ΔpagA (triple toxin deletion) (11)
BAP708
BA417 with construct 4 (Signatures 1–5)
This study
Plasmid Description Source
pT7 Blue Cloning vector Novagen-MilliporeSigma, St. Louis, MO, USA
pT7 Blue::4 Construct 4 (Signatures 1–5) This study
pRP1091
Δlef derivative of shuttle vector pRP1028
(11)
Primer Sequence, 5′ → 3′ Application
RP411 TTTCACACAGGAAACAGCTATGACC Amplify constructs
RP645 CCAGTCACGACGTTGTAAAACGAC Amplify constructs
SS2178 GTAAATTATTTAGCAAGTAAATTTTGGTG Sequence constructs
RP214 TATGGTCTCGGATCCTTTGGCTTTAACGAAATGTATGTGC Diagnose, sequence lef
RP215 TATGGTCTCCGGCCGTTTCAGTTATTCATTCTGGATAGTC Diagnose, sequence lef
SS2164 CACGAGAAGAGTATTTAAAGAAAATC Diagnose lef
SS2165 AACTATAGGACAATATTCATTACCATG Diagnose lef
SS2166 ATATCAAGTTTAATTGTTAAGTTTGAAGG Diagnose cya
SS2167 CCCGCGGCCGCAACCAAATGGTTTTCATTTCTTAG Diagnose cya
SS2168 CGCATATAAGCAAATACTTAATTGGTC Diagnose pagA
SS2169 GGATAGGGTTTAACAACTTAATAATCCC Diagnose pagA

Main Article

References
  1. Lieberman  J, Ridge  T, Shalala  D, Daschle  T, Greenwood  J, Wainstein  K. Blue Ribbon Study Panel on Biodefense Report: a national blueprint for biodefense: leadership and major reform needed to optimize efforts [cited 2015 Oct 28]. http://potomacinstitute.org/featured-news/1819-biodefense-blueprint-2
  2. Imperiale  MJ, Casadevall  A. Bioterrorism: lessons learned since the anthrax mailings. MBio. 2011;2:e00232–11. DOIPubMedGoogle Scholar
  3. Sozhamannan  S, Smith  M, Setlow  P, Hanna  PC. On the origin of live spores in gamma irradiated spore preparations a perfect example of Poisson distribution. ASM Microbe. 2016 Jan:4–5.
  4. US Department of Defense. DoD launches review of lab procedures involving anthrax [cited 2015 May 29]. https://www.defense.gov/News/Article/Article/604749
  5. US Department of Defense. Committee for Comprehensive Review of DoD Laboratory Procedures, Processes, and Protocols Associated with Inactivating Bacillus anthracis Spores. Review committee report: inadvertent shipment of live Bacillus anthracis spores by DoD [cited 2017 Aug 26]. https://www.defense.gov/Portals/1/features/2015/0615_lab-stats/Review-Committee-Report-Final.pdf
  6. Secretary of the Army. Memorandum: immediate safety review and extension of moratorium. 2015 Sep 2 [cited 2017 Aug 26]. https://www.defense.gov/Portals/1/Documents/BSAT_Safety_Review_directive.pdf
  7. Secretary of the Army. Memorandum: Army Directive 2016-24 (Department of Defense Biological Select Agent and Toxins Biosafety Program). 2016 Jul 25 [cited 2017 Aug 26]. http://armypubs.army.mil/epubs/DR_pubs/DR_a/pdf/web/Army%20Directive%202016-24%20Final.pdf
  8. Deputy Secretary of Defense. Implementation of the recommendations in the comprehensive review report: inadvertent shipment of live Bacillus anthracis (anthrax) spores by Department of Defense. 2015 Jul 23 [cited 2017 Aug 26]. https://www.defense.gov/Portals/1/features/2015/0615_lab-stats/docs/DSD-Memo-Implementation-of-Recommendations-in-Comprehensive-Review-Report.pdf
  9. Simon  R, Priefer  U, Puhler  A. A broad host range mobilization system for in vivo genetic-engineering: transposon mutagenesis in gram-negative bacteria. Nat Biotechnol. 1983;1:784–91. DOIGoogle Scholar
  10. Stibitz  S, Carbonetti  NH. Hfr mapping of mutations in Bordetella pertussis that define a genetic locus involved in virulence gene regulation. J Bacteriol. 1994;176:7260–6. DOIPubMedGoogle Scholar
  11. Plaut  RD, Stibitz  S. Improvements to a markerless allelic exchange system for Bacillus anthracis. PLoS One. 2015;10:e0142758. DOIPubMedGoogle Scholar
  12. Hoffmaster  AR, Meyer  RF, Bowen  MD, Marston  CK, Weyant  RS, Thurman  K, et al. Evaluation and validation of a real-time polymerase chain reaction assay for rapid identification of Bacillus anthracis. Emerg Infect Dis. 2002;8:1178–82. DOIPubMedGoogle Scholar
  13. Nicholson  W, Setlow  P. Molecular biological methods for Bacillus. New York: John Wiley; 1990.
  14. Thomas  D, Naughton  J, Cote  C, Welkos  S, Manchester  M, Young  JA. Delayed toxicity associated with soluble anthrax toxin receptor decoy-Ig fusion protein treatment. PLoS One. 2012;7:e34611. DOIPubMedGoogle Scholar
  15. Atrih  A, Foster  SJ. Analysis of the role of bacterial endospore cortex structure in resistance properties and demonstration of its conservation amongst species. J Appl Microbiol. 2001;91:364–72. DOIPubMedGoogle Scholar
  16. Buhr  TL, Young  AA, Minter  ZA, Wells  CM, McPherson  DC, Hooban  CL, et al. Test method development to evaluate hot, humid air decontamination of materials contaminated with Bacillus anthracis ∆Sterne and B. thuringiensis Al Hakam spores. J Appl Microbiol. 2012;113:1037–51. DOIPubMedGoogle Scholar
  17. Gladstone  GP, Fildes  P. A simple culture medium for general use without meat extract or peptone. Br J Exp Pathol. 1940;21:161–73.
  18. Camp  DW, Montgomery  NK. How good labs can get wrong results—keys to accurate and reproducible quantitation of Bacillus anthracis spore sampling or extraction efficiency. Presented at: Third National Conference on Environmental Sampling and Detection for Biol-Threat Agents. Las Vegas, NV, USA; 2008 Dec 2–4.
  19. Buhr  TL, Wells  CM, Young  AA, Minter  ZA, Johnson  CA, Payne  AN, et al. Decontamination of materials contaminated with Bacillus anthracis and Bacillus thuringiensis Al Hakam spores using PES-Solid, a solid source of peracetic acid. J Appl Microbiol. 2013;115:398–408. DOIPubMedGoogle Scholar
  20. Federal Select Agent Program. Revised FSAP policy statement: inactivated Bacillus anthracis and Bacillus cereus biovar anthracis. August 14, 2017 [cited 2017 Aug 26]. https://www.selectagents.gov/policystatement_bacillus.html
  21. Bishop-Lilly  KA, Plaut  RD, Chen  PE, Akmal  A, Willner  KM, Butani  A, et al. Whole genome sequencing of phage resistant Bacillus anthracis mutants reveals an essential role for cell surface anchoring protein CsaB in phage AP50c adsorption. Virol J. 2012;9:246. DOIPubMedGoogle Scholar
  22. BSP- Biol Spec products. Mini-Bead Beater-8- Preparation of sample [cited 2017 Nov 21]. https://biospec.com/instructions/minibeadbeater_8
  23. Centers for Disease Control and Prevention. Federal Select Agent Program: select agents and toxins list. 2017 [cited 2017 Aug 24]. https://www.selectagents.gov/SelectAgentsandToxinsList.html
  24. Loving  CL, Khurana  T, Osorio  M, Lee  GM, Kelly  VK, Stibitz  S, et al. Role of anthrax toxins in dissemination, disease progression, and induction of protective adaptive immunity in the mouse aerosol challenge model. Infect Immun. 2009;77:255–65. DOIPubMedGoogle Scholar
  25. Buhr  TL, Young  AA, Minter  ZA, Wells  CM, Shegogue  DA. Decontamination of a hard surface contaminated with Bacillus anthracisΔSterne and B. anthracis Ames spores using electrochemically generated liquid-phase chlorine dioxide (eClO2). J Appl Microbiol. 2011;111:1057–64. DOIPubMedGoogle Scholar
  26. Lyons  CR, Lovchik  J, Hutt  J, Lipscomb  MF, Wang  E, Heninger  S, et al. Murine model of pulmonary anthrax: kinetics of dissemination, histopathology, and mouse strain susceptibility. Infect Immun. 2004;72:4801–9. DOIPubMedGoogle Scholar
  27. Staab  A, Plaut  RD, Pratt  C, Lovett  SP, Wiley  MR, Biggs  TD, et al. Whole-genome sequences of variants of Bacillus anthracis Sterne and their toxin gene deletion mutants. Genome Announc. 2017;5:e01231–17. DOIPubMedGoogle Scholar
  28. Waller  DF, Hew  BE, Holdaway  C, Jen  M, Peckham  GD. Rapid detection of Bacillus anthracis spores using immunomagnetic separation and amperometry. Biosensors (Basel). 2016;6:E61. DOIPubMedGoogle Scholar
  29. Biagini  RE, Sammons  DL, Smith  JP, MacKenzie  BA, Striley  CA, Snawder  JE, et al. Rapid, sensitive, and specific lateral-flow immunochromatographic device to measure anti-anthrax protective antigen immunoglobulin g in serum and whole blood. Clin Vaccine Immunol. 2006;13:541–6. DOIPubMedGoogle Scholar
  30. Sozhamannan  S, McKinstry  M, Lentz  SM, Jalasvuori  M, McAfee  F, Smith  A, et al. Molecular characterization of a variant of Bacillus anthracis-specific phage AP50 with improved bacteriolytic activity. Appl Environ Microbiol. 2008;74:6792–6. DOIPubMedGoogle Scholar
  31. Mignot  T, Mesnage  S, Couture-Tosi  E, Mock  M, Fouet  A. Developmental switch of S-layer protein synthesis in Bacillus anthracis. Mol Microbiol. 2002;43:1615–27. DOIPubMedGoogle Scholar
  32. Plaut  RD, Beaber  JW, Zemansky  J, Kaur  AP, George  M, Biswas  B, et al. Genetic evidence for the involvement of the S-layer protein gene sap and the sporulation genes spo0A, spo0B, and spo0F in Phage AP50c infection of Bacillus anthracis. J Bacteriol. 2014;196:1143–54. DOIPubMedGoogle Scholar
  33. Welkos  SL, Keener  TJ, Gibbs  PH. Differences in susceptibility of inbred mice to Bacillus anthracis. Infect Immun. 1986;51:795–800.PubMedGoogle Scholar
  34. Wilson  MK, Vergis  JM, Alem  F, Palmer  JR, Keane-Myers  AM, Brahmbhatt  TN, et al. Bacillus cereus G9241 makes anthrax toxin and capsule like highly virulent B. anthracis Ames but behaves like attenuated toxigenic nonencapsulated B. anthracis Sterne in rabbits and mice. Infect Immun. 2011;79:3012–9. DOIPubMedGoogle Scholar
  35. Meselson  M, Guillemin  J, Hugh-Jones  M, Langmuir  A, Popova  I, Shelokov  A, et al. The Sverdlovsk anthrax outbreak of 1979. Science. 1994;266:1202–8. DOIPubMedGoogle Scholar
  36. Centers for Disease Control and Prevention. Conclusion of select agent inquiry into Burkholderia pseudomallei release at Tulane National Primate Research Center. 2015 Mar 13 [cited 2017 Aug 26]. http://www.cdc.gov/media/releases/2015/s0313-burkholderia-pseudomallei.html
  37. US Department of Justice. Amerithrax investigative summary. 2010 Feb 19 [cited 2017 Aug 26]. www.justice.gov/amerithrax/docs/amx-investigative-summary.pdf
  38. Straub  T, Baird  C, Bartholomew  RA, Colburn  H, Seiner  D, Victry  K, et al. Estimated copy number of Bacillus anthracis plasmids pXO1 and pXO2 using digital PCR. J Microbiol Methods. 2013;92:9–10. DOIPubMedGoogle Scholar
  39. Noda  T, Sagara  H, Suzuki  E, Takada  A, Kida  H, Kawaoka  Y. Ebola virus VP40 drives the formation of virus-like filamentous particles along with GP. J Virol. 2002;76:4855–65. DOIPubMedGoogle Scholar
  40. Warfield  KL, Swenson  DL, Demmin  G, Bavari  S. Filovirus-like particles as vaccines and discovery tools. Expert Rev Vaccines. 2005;4:429–40. DOIPubMedGoogle Scholar

Main Article

Page created: March 19, 2018
Page updated: March 19, 2018
Page reviewed: March 19, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external