Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 25, Number 11—November 2019

Research

Rare Detection of Bordetella pertussis Pertactin-Deficient Strains in Argentina

Francisco Carriquiriborde1, Victoria Regidor1, Pablo M. Aispuro1, Gabrielli Magali1, Erika Bartel, Daniela Bottero, and Daniela HozborComments to Author 
Author affiliations: Universidad Nacional de La Plata y Consejo Nacional de Investigaciones Científicas y Técnicas, La Plata, Argentina

Main Article

Table 2

Primers used in PCR for Bordetella pertussis strains studied, Argentina, 2000–2017*

Gene†
Primer sequence, 5′→3′
Reference(s)
ptxP F: AATCGTCCTGCTCAACCGCC (27,28)
R: GGTATACGGTGGCGGGAGGA
ptxA F: CCCCTGCCATGGTGTGATC (29)
R: TCAATTACCGGAGTTGGGCG
prn F: CAATGTCACGGTCCAA (26)
R: GCAAGGTGATCGACAGGG
fim3 F: GACCTGATATTCTGATGCCG (31)
R: AAGGCTTGCCGGTTTTTTTTGG

*F, forward; R, reverse.
†fim3, fimbriae type 3; prn, pertactin; ptxA, pertussis toxin subunit A, ptxP, pertussis toxin promoter.

Main Article

References
  1. Stephenson  JB. Reactions to whooping cough vaccine. BMJ. 1979;2:933. DOIPubMedGoogle Scholar
  2. Pertussis vaccines: WHO position paper. Wkly Epidemiol Rec. 2010;85:385–400.PubMedGoogle Scholar
  3. Yeung  KHT, Duclos  P, Nelson  EAS, Hutubessy  RCW. An update of the global burden of pertussis in children younger than 5 years: a modelling study. Lancet Infect Dis. 2017;17:974–80. DOIPubMedGoogle Scholar
  4. Clark  TA. Changing pertussis epidemiology: everything old is new again. J Infect Dis. 2014;209:978–81. DOIPubMedGoogle Scholar
  5. Vizzotti  C, Juarez  MV, Bergel  E, Romanin  V, Califano  G, Sagradini  S, et al. Impact of a maternal immunization program against pertussis in a developing country. Vaccine. 2016;34:6223–8. DOIPubMedGoogle Scholar
  6. Falleiros Arlant  LH, de Colsa  A, Flores  D, Brea  J, Avila Aguero  ML, Hozbor  DF. Pertussis in Latin America: epidemiology and control strategies. Expert Rev Anti Infect Ther. 2014;12:1265–75. DOIPubMedGoogle Scholar
  7. Wendelboe  AM, Van Rie  A, Salmaso  S, Englund  JA. Duration of immunity against pertussis after natural infection or vaccination. Pediatr Infect Dis J. 2005;24(Suppl):S58–61. DOIPubMedGoogle Scholar
  8. McGirr  A, Fisman  DN. Duration of pertussis immunity after DTaP immunization: a meta-analysis. Pediatrics. 2015;135:331–43. DOIPubMedGoogle Scholar
  9. Mooi  FR, Van Der Maas  NA, De Melker  HE. Pertussis resurgence: waning immunity and pathogen adaptation - two sides of the same coin. Epidemiol Infect. 2014;142:685–94. DOIPubMedGoogle Scholar
  10. Lam  C, Octavia  S, Ricafort  L, Sintchenko  V, Gilbert  GL, Wood  N, et al. Rapid increase in pertactin-deficient Bordetella pertussis isolates, Australia. Emerg Infect Dis. 2014;20:626–33. DOIPubMedGoogle Scholar
  11. Advani  A, Gustafsson  L, Ahrén  C, Mooi  FR, Hallander  HO. Appearance of Fim3 and ptxP3-Bordetella pertussis strains, in two regions of Sweden with different vaccination programs. Vaccine. 2011;29:3438–42. DOIPubMedGoogle Scholar
  12. Kallonen  T, Mertsola  J, Mooi  FR, He  Q. Rapid detection of the recently emerged Bordetella pertussis strains with the ptxP3 pertussis toxin promoter allele by real-time PCR. Clin Microbiol Infect. 2012;18:E377–9. DOIPubMedGoogle Scholar
  13. Hegerle  N, Guiso  N. Bordetella pertussis and pertactin-deficient clinical isolates: lessons for pertussis vaccines. Expert Rev Vaccines. 2014;13:1135–46. DOIPubMedGoogle Scholar
  14. Bodilis  H, Guiso  N. Virulence of pertactin-negative Bordetella pertussis isolates from infants, France. Emerg Infect Dis. 2013;19:471–4. DOIPubMedGoogle Scholar
  15. Pawloski  LC, Queenan  AM, Cassiday  PK, Lynch  AS, Harrison  MJ, Shang  W, et al. Prevalence and molecular characterization of pertactin-deficient Bordetella pertussis in the United States. Clin Vaccine Immunol. 2014;21:119–25. DOIPubMedGoogle Scholar
  16. Tsang  RS, Shuel  M, Jamieson  FB, Drews  S, Hoang  L, Horsman  G, et al. Pertactin-negative Bordetella pertussis strains in Canada: characterization of a dozen isolates based on a survey of 224 samples collected in different parts of the country over the last 20 years. Int J Infect Dis. 2014;28:65–9. DOIPubMedGoogle Scholar
  17. Safarchi  A, Octavia  S, Luu  LD, Tay  CY, Sintchenko  V, Wood  N, et al. Pertactin negative Bordetella pertussis demonstrates higher fitness under vaccine selection pressure in a mixed infection model. Vaccine. 2015;33:6277–81. DOIPubMedGoogle Scholar
  18. Centers for Disease Control and Prevention. Pertussis/whooping Cough (Bordetella pertussis). Case definition; 2014 [cited 2019 Aug 4]. https://wwwn.cdc.gov/nndss/conditions/pertussis/case-definition/2014
  19. World Health Organization. WHO-recommended surveillance standard of pertussis [cited 2019 Aug 4]. https://wwwwhoint/immunization/monitoring_surveillance/burden/vpd/surveillance_type/passive/pertussis_standards/en
  20. Argentina Ministry of Health. Whopping cough and convulsions of pertussis. Case definitions [in Spanish] [cited 2019 Aug 5]. http://www.msal.gob.ar/images/stories/pdf/coqueluche-recomendaciones-definiciones.pdf
  21. Gentile  A. [Bordetella pertussis infection] [in Spanish]. Arch Argent Pediatr. 2010;108:78–81.PubMedGoogle Scholar
  22. Grimprel  E, Bégué  P, Anjak  I, Betsou  F, Guiso  N. Comparison of polymerase chain reaction, culture, and western immunoblot serology for diagnosis of Bordetella pertussis infection. J Clin Microbiol. 1993;31:2745–50.PubMedGoogle Scholar
  23. Hozbor  D, Fouque  F, Guiso  N. Detection of Bordetella bronchiseptica by the polymerase chain reaction. Res Microbiol. 1999;150:333–41. DOIPubMedGoogle Scholar
  24. Schouls  LM, van der Heide  HG, Vauterin  L, Vauterin  P, Mooi  FR. Multiple-locus variable-number tandem repeat analysis of Dutch Bordetella pertussis strains reveals rapid genetic changes with clonal expansion during the late 1990s. J Bacteriol. 2004;186:5496–505. DOIPubMedGoogle Scholar
  25. Mooi  FR, van Loo  IH, van Gent  M, He  Q, Bart  MJ, Heuvelman  KJ, et al. Bordetella pertussis strains with increased toxin production associated with pertussis resurgence. Emerg Infect Dis. 2009;15:1206–13. DOIPubMedGoogle Scholar
  26. Fiett  J, Letowska  I, Gniadkowski  M, Hryniewicz  W. The new strategy for allele identification of the genes coding for pertussis toxin subunit S1 (ptx S1) and pertactin (prn) in Bordetella pertussis. J Microbiol Methods. 2003;55:651–66. DOIPubMedGoogle Scholar
  27. Mooi  FR, Hallander  H, Wirsing von König  CH, Hoet  B, Guiso  N. Epidemiological typing of Bordetella pertussis isolates: recommendations for a standard methodology. Eur J Clin Microbiol Infect Dis. 2000;19:174–81. DOIPubMedGoogle Scholar
  28. Borisova  O, Kombarova  SY, Zakharova  NS, van Gent  M, Aleshkin  VA, Mazurova  I, et al. Antigenic divergence between Bordetella pertussis clinical isolates from Moscow, Russia, and vaccine strains. Clin Vaccine Immunol. 2007;14:234–8. DOIPubMedGoogle Scholar
  29. Advani  A, Donnelly  D, Hallander  H. Reference system for characterization of Bordetella pertussis pulsed-field gel electrophoresis profiles. J Clin Microbiol. 2004;42:2890–7. DOIPubMedGoogle Scholar
  30. Bottero  D, Gaillard  ME, Fingermann  M, Weltman  G, Fernández  J, Sisti  F, et al. Pulsed-field gel electrophoresis, pertactin, pertussis toxin S1 subunit polymorphisms, and surfaceome analysis of vaccine and clinical Bordetella pertussis strains. Clin Vaccine Immunol. 2007;14:1490–8. DOIPubMedGoogle Scholar
  31. van Loo  IH, Heuvelman  KJ, King  AJ, Mooi  FR. Multilocus sequence typing of Bordetella pertussis based on surface protein genes. J Clin Microbiol. 2002;40:1994–2001. DOIPubMedGoogle Scholar
  32. Hardwick  TH, Plikaytis  B, Cassiday  PK, Cage  G, Peppler  MS, Shea  D, et al. Reproducibility of Bordetella pertussis genomic DNA fragments generated by XbaI restriction and resolved by pulsed-field gel electrophoresis. J Clin Microbiol. 2002;40:811–6. DOIPubMedGoogle Scholar
  33. Hunter  PR, Gaston  MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988;26:2465–6.PubMedGoogle Scholar
  34. Network E-Ls. External quality assurance scheme for Bordetella identification and B. pertussis typing [cited 2019 Aug 4]. https://ecdc.europa.eu/sites/portal/files/media/en/publications/Publications/EQA-pertussis-Bordetella-ID-B-typing.pdf
  35. Barkoff  AM, Mertsola  J, Pierard  D, Dalby  T, Hoegh  SV, Guillot  S, et al. Surveillance of circulating Bordetella pertussis strains in Europe during 1998 to 2015. J Clin Microbiol. 2018;56:e01998–17. DOIPubMedGoogle Scholar
  36. Bottero  D, Gaillard  ME, Basile  LA, Fritz  M, Hozbor  DF. Genotypic and phenotypic characterization of Bordetella pertussis strains used in different vaccine formulations in Latin America. J Appl Microbiol. 2012;112:1266–76. DOIPubMedGoogle Scholar
  37. van Gent  M, van Loo  IH, Heuvelman  KJ, de Neeling  AJ, Teunis  P, Mooi  FR. Studies on Prn variation in the mouse model and comparison with epidemiological data. PLoS One. 2011;6:e18014. DOIPubMedGoogle Scholar
  38. Polak  M, Zasada  AA, Mosiej  E, Krysztopa-Grzybowska  K, Witkowski  L, Rzeczkowska  M, et al. Pertactin-deficient Bordetella pertussis isolates in Poland: a country with whole-cell pertussis primary vaccination. Microbes Infect. 2018;Dec 21:pii: S11286-4579(18)30193-X.
  39. Quinlan  T, Musser  KA, Currenti  SA, Zansky  SM, Halse  TA. Pertactin-negative variants of Bordetella pertussis in New York State: a retrospective analysis, 2004-2013. Mol Cell Probes. 2014;28:138–40. DOIPubMedGoogle Scholar
  40. Queenan  AM, Cassiday  PK, Evangelista  A. Pertactin-negative variants of Bordetella pertussis in the United States. N Engl J Med. 2013;368:583–4. DOIPubMedGoogle Scholar
  41. Martin  SW, Pawloski  L, Williams  M, Weening  K, DeBolt  C, Qin  X, et al. Pertactin-negative Bordetella pertussis strains: evidence for a possible selective advantage. Clin Infect Dis. 2015;60:223–7. DOIPubMedGoogle Scholar
  42. Hegerle  N, Dore  G, Guiso  N. Pertactin deficient Bordetella pertussis present a better fitness in mice immunized with an acellular pertussis vaccine. Vaccine. 2014;32:6597–600. DOIPubMedGoogle Scholar
  43. Clarke  M, McIntyre  PB, Blyth  CC, Wood  N, Octavia  S, Sintchenko  V, et al. The relationship between Bordetella pertussis genotype and clinical severity in Australian children with pertussis. J Infect. 2016;72:171–8. DOIPubMedGoogle Scholar

Main Article

1These authors contributed equally to this article.

Page created: October 15, 2019
Page updated: October 15, 2019
Page reviewed: October 15, 2019
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external