Volume 25, Number 11—November 2019
Research
Rare Detection of Bordetella pertussis Pertactin-Deficient Strains in Argentina
Table 2
Primers used in PCR for Bordetella pertussis strains studied, Argentina, 2000–2017*
Gene† |
Primer sequence, 5′→3′ |
Reference(s) |
ptxP | F: AATCGTCCTGCTCAACCGCC | (27,28) |
R: GGTATACGGTGGCGGGAGGA | ||
ptxA | F: CCCCTGCCATGGTGTGATC | (29) |
R: TCAATTACCGGAGTTGGGCG | ||
prn | F: CAATGTCACGGTCCAA | (26) |
R: GCAAGGTGATCGACAGGG | ||
fim3 | F: GACCTGATATTCTGATGCCG | (31) |
R: AAGGCTTGCCGGTTTTTTTTGG |
*F, forward; R, reverse.
†fim3, fimbriae type 3; prn, pertactin; ptxA, pertussis toxin subunit A, ptxP, pertussis toxin promoter.
References
- Yeung KHT, Duclos P, Nelson EAS, Hutubessy RCW. An update of the global burden of pertussis in children younger than 5 years: a modelling study. Lancet Infect Dis. 2017;17:974–80. DOIPubMedGoogle Scholar
- Clark TA. Changing pertussis epidemiology: everything old is new again. J Infect Dis. 2014;209:978–81. DOIPubMedGoogle Scholar
- Vizzotti C, Juarez MV, Bergel E, Romanin V, Califano G, Sagradini S, et al. Impact of a maternal immunization program against pertussis in a developing country. Vaccine. 2016;34:6223–8. DOIPubMedGoogle Scholar
- Falleiros Arlant LH, de Colsa A, Flores D, Brea J, Avila Aguero ML, Hozbor DF. Pertussis in Latin America: epidemiology and control strategies. Expert Rev Anti Infect Ther. 2014;12:1265–75. DOIPubMedGoogle Scholar
- Wendelboe AM, Van Rie A, Salmaso S, Englund JA. Duration of immunity against pertussis after natural infection or vaccination. Pediatr Infect Dis J. 2005;24(Suppl):S58–61. DOIPubMedGoogle Scholar
- McGirr A, Fisman DN. Duration of pertussis immunity after DTaP immunization: a meta-analysis. Pediatrics. 2015;135:331–43. DOIPubMedGoogle Scholar
- Mooi FR, Van Der Maas NA, De Melker HE. Pertussis resurgence: waning immunity and pathogen adaptation - two sides of the same coin. Epidemiol Infect. 2014;142:685–94. DOIPubMedGoogle Scholar
- Lam C, Octavia S, Ricafort L, Sintchenko V, Gilbert GL, Wood N, et al. Rapid increase in pertactin-deficient Bordetella pertussis isolates, Australia. Emerg Infect Dis. 2014;20:626–33. DOIPubMedGoogle Scholar
- Advani A, Gustafsson L, Ahrén C, Mooi FR, Hallander HO. Appearance of Fim3 and ptxP3-Bordetella pertussis strains, in two regions of Sweden with different vaccination programs. Vaccine. 2011;29:3438–42. DOIPubMedGoogle Scholar
- Kallonen T, Mertsola J, Mooi FR, He Q. Rapid detection of the recently emerged Bordetella pertussis strains with the ptxP3 pertussis toxin promoter allele by real-time PCR. Clin Microbiol Infect. 2012;18:E377–9. DOIPubMedGoogle Scholar
- Hegerle N, Guiso N. Bordetella pertussis and pertactin-deficient clinical isolates: lessons for pertussis vaccines. Expert Rev Vaccines. 2014;13:1135–46. DOIPubMedGoogle Scholar
- Bodilis H, Guiso N. Virulence of pertactin-negative Bordetella pertussis isolates from infants, France. Emerg Infect Dis. 2013;19:471–4. DOIPubMedGoogle Scholar
- Pawloski LC, Queenan AM, Cassiday PK, Lynch AS, Harrison MJ, Shang W, et al. Prevalence and molecular characterization of pertactin-deficient Bordetella pertussis in the United States. Clin Vaccine Immunol. 2014;21:119–25. DOIPubMedGoogle Scholar
- Tsang RS, Shuel M, Jamieson FB, Drews S, Hoang L, Horsman G, et al. Pertactin-negative Bordetella pertussis strains in Canada: characterization of a dozen isolates based on a survey of 224 samples collected in different parts of the country over the last 20 years. Int J Infect Dis. 2014;28:65–9. DOIPubMedGoogle Scholar
- Safarchi A, Octavia S, Luu LD, Tay CY, Sintchenko V, Wood N, et al. Pertactin negative Bordetella pertussis demonstrates higher fitness under vaccine selection pressure in a mixed infection model. Vaccine. 2015;33:6277–81. DOIPubMedGoogle Scholar
- Centers for Disease Control and Prevention. Pertussis/whooping Cough (Bordetella pertussis). Case definition; 2014 [cited 2019 Aug 4]. https://wwwn.cdc.gov/nndss/conditions/pertussis/case-definition/2014
- World Health Organization. WHO-recommended surveillance standard of pertussis [cited 2019 Aug 4]. https://wwwwhoint/immunization/monitoring_surveillance/burden/vpd/surveillance_type/passive/pertussis_standards/en
- Argentina Ministry of Health. Whopping cough and convulsions of pertussis. Case definitions [in Spanish] [cited 2019 Aug 5]. http://www.msal.gob.ar/images/stories/pdf/coqueluche-recomendaciones-definiciones.pdf
- Gentile A. [Bordetella pertussis infection] [in Spanish]. Arch Argent Pediatr. 2010;108:78–81.PubMedGoogle Scholar
- Grimprel E, Bégué P, Anjak I, Betsou F, Guiso N. Comparison of polymerase chain reaction, culture, and western immunoblot serology for diagnosis of Bordetella pertussis infection. J Clin Microbiol. 1993;31:2745–50.PubMedGoogle Scholar
- Hozbor D, Fouque F, Guiso N. Detection of Bordetella bronchiseptica by the polymerase chain reaction. Res Microbiol. 1999;150:333–41. DOIPubMedGoogle Scholar
- Schouls LM, van der Heide HG, Vauterin L, Vauterin P, Mooi FR. Multiple-locus variable-number tandem repeat analysis of Dutch Bordetella pertussis strains reveals rapid genetic changes with clonal expansion during the late 1990s. J Bacteriol. 2004;186:5496–505. DOIPubMedGoogle Scholar
- Mooi FR, van Loo IH, van Gent M, He Q, Bart MJ, Heuvelman KJ, et al. Bordetella pertussis strains with increased toxin production associated with pertussis resurgence. Emerg Infect Dis. 2009;15:1206–13. DOIPubMedGoogle Scholar
- Fiett J, Letowska I, Gniadkowski M, Hryniewicz W. The new strategy for allele identification of the genes coding for pertussis toxin subunit S1 (ptx S1) and pertactin (prn) in Bordetella pertussis. J Microbiol Methods. 2003;55:651–66. DOIPubMedGoogle Scholar
- Mooi FR, Hallander H, Wirsing von König CH, Hoet B, Guiso N. Epidemiological typing of Bordetella pertussis isolates: recommendations for a standard methodology. Eur J Clin Microbiol Infect Dis. 2000;19:174–81. DOIPubMedGoogle Scholar
- Borisova O, Kombarova SY, Zakharova NS, van Gent M, Aleshkin VA, Mazurova I, et al. Antigenic divergence between Bordetella pertussis clinical isolates from Moscow, Russia, and vaccine strains. Clin Vaccine Immunol. 2007;14:234–8. DOIPubMedGoogle Scholar
- Advani A, Donnelly D, Hallander H. Reference system for characterization of Bordetella pertussis pulsed-field gel electrophoresis profiles. J Clin Microbiol. 2004;42:2890–7. DOIPubMedGoogle Scholar
- Bottero D, Gaillard ME, Fingermann M, Weltman G, Fernández J, Sisti F, et al. Pulsed-field gel electrophoresis, pertactin, pertussis toxin S1 subunit polymorphisms, and surfaceome analysis of vaccine and clinical Bordetella pertussis strains. Clin Vaccine Immunol. 2007;14:1490–8. DOIPubMedGoogle Scholar
- van Loo IH, Heuvelman KJ, King AJ, Mooi FR. Multilocus sequence typing of Bordetella pertussis based on surface protein genes. J Clin Microbiol. 2002;40:1994–2001. DOIPubMedGoogle Scholar
- Hardwick TH, Plikaytis B, Cassiday PK, Cage G, Peppler MS, Shea D, et al. Reproducibility of Bordetella pertussis genomic DNA fragments generated by XbaI restriction and resolved by pulsed-field gel electrophoresis. J Clin Microbiol. 2002;40:811–6. DOIPubMedGoogle Scholar
- Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988;26:2465–6.PubMedGoogle Scholar
- Network E-Ls. External quality assurance scheme for Bordetella identification and B. pertussis typing [cited 2019 Aug 4]. https://ecdc.europa.eu/sites/portal/files/media/en/publications/Publications/EQA-pertussis-Bordetella-ID-B-typing.pdf
- Barkoff AM, Mertsola J, Pierard D, Dalby T, Hoegh SV, Guillot S, et al. Surveillance of circulating Bordetella pertussis strains in Europe during 1998 to 2015. J Clin Microbiol. 2018;56:e01998–17. DOIPubMedGoogle Scholar
- Bottero D, Gaillard ME, Basile LA, Fritz M, Hozbor DF. Genotypic and phenotypic characterization of Bordetella pertussis strains used in different vaccine formulations in Latin America. J Appl Microbiol. 2012;112:1266–76. DOIPubMedGoogle Scholar
- van Gent M, van Loo IH, Heuvelman KJ, de Neeling AJ, Teunis P, Mooi FR. Studies on Prn variation in the mouse model and comparison with epidemiological data. PLoS One. 2011;6:
e18014 . DOIPubMedGoogle Scholar - Polak M, Zasada AA, Mosiej E, Krysztopa-Grzybowska K, Witkowski L, Rzeczkowska M, et al. Pertactin-deficient Bordetella pertussis isolates in Poland: a country with whole-cell pertussis primary vaccination. Microbes Infect. 2018;Dec 21:pii: S11286-4579(18)30193-X.
- Quinlan T, Musser KA, Currenti SA, Zansky SM, Halse TA. Pertactin-negative variants of Bordetella pertussis in New York State: a retrospective analysis, 2004-2013. Mol Cell Probes. 2014;28:138–40. DOIPubMedGoogle Scholar
- Queenan AM, Cassiday PK, Evangelista A. Pertactin-negative variants of Bordetella pertussis in the United States. N Engl J Med. 2013;368:583–4. DOIPubMedGoogle Scholar
- Martin SW, Pawloski L, Williams M, Weening K, DeBolt C, Qin X, et al. Pertactin-negative Bordetella pertussis strains: evidence for a possible selective advantage. Clin Infect Dis. 2015;60:223–7. DOIPubMedGoogle Scholar
- Hegerle N, Dore G, Guiso N. Pertactin deficient Bordetella pertussis present a better fitness in mice immunized with an acellular pertussis vaccine. Vaccine. 2014;32:6597–600. DOIPubMedGoogle Scholar
- Clarke M, McIntyre PB, Blyth CC, Wood N, Octavia S, Sintchenko V, et al. The relationship between Bordetella pertussis genotype and clinical severity in Australian children with pertussis. J Infect. 2016;72:171–8. DOIPubMedGoogle Scholar
1These authors contributed equally to this article.
Page created: October 15, 2019
Page updated: October 15, 2019
Page reviewed: October 15, 2019
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.