Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 28, Number 12—December 2022
Dispatch

Natural Mediterranean Spotted Fever Foci, Qingdao, China

Xiao-Lan Gu, Rui Wang, Chuan-Min Zhou, Jiang-Tao Cui, Ze-Min Li, Ze-Zheng Jiang, Bang Li, Qiu-Ming Peng, Wen-Kang Zhang, Hui-Ju HanComments to Author , and Xue-Jie YuComments to Author 
Author affiliations: Wuhan University, Wuhan, China (X.-L. Gu, R. Wang, C.-M. Zhou, Z.-M. Li, Z.-Z. Jiang, B. Li, Q.-M. Peng, W.-K. Zhang, H.-J. Han, X.-J. Yu); Laixi City for Disease Control and Prevention, Qingdao, China (J.-T. Cui)

Main Article

Table 1

Primers used for amplification of spotted fever group Rickettsia from natural Mediterranean spotted fever foci, Qingdao City, China*

Target gene Primer Nucleotide sequence, 5′ → 3′ Length, bp Reference
17 kDa antigen F1 CATTGTCCGTCAGGTTGGCG 371 (12)
R1 GGAACACTTCTTGGCGGTG
F2 AACCGTAATTGCCGTTATCCGG 214
R2
 GCATTACTTGGTTCTCAATTCGG
16S rRNA F1 TGATCCTGGCTCAGAACGAAC 1,486 (12)
R1 TAAGGAGGTAATCCAGCCGC
F2 AACACATGCAAGTCGRACGG 1,371
R2
 GGCTGCCTCTTGCGTTAGCT
Outer membrane protein A F ATGGCGAATATTTCTCCAAAA 536 (13)
R
 AGTGCAGCATTCGCTCCCCCT
Outer membrane protein B F1 ATATGCAGGTATCGGTACT 1,355 (12)
R1 CCATATACCGTAAGCTACAT
F2 GCAGGTATCGGTACTATAAAC 843
R2 AATTTACGAAACGATTACTTCCGG

*Samples studied were from rodents collected in Huangdao District, Qingdao, China, during July–October every year in 2013–2015. The rodent collection was described in a previous study (11). F, forward; R, reverse.

Main Article

References
  1. Colomba  C, Saporito  L, Polara  VF, Rubino  R, Titone  L. Mediterranean spotted fever: clinical and laboratory characteristics of 415 Sicilian children. BMC Infect Dis. 2006;6:60. DOIPubMedGoogle Scholar
  2. Rovery  C, Brouqui  P, Raoult  D. Questions on Mediterranean spotted fever a century after its discovery. Emerg Infect Dis. 2008;14:1360–7. DOIPubMedGoogle Scholar
  3. Megaw  JWD. Indian Tick-Typhus. Ind Med Gaz. 1925;60:58–61.PubMedGoogle Scholar
  4. Sentausa  E, El Karkouri  K, Robert  C, Raoult  D, Fournier  PE. Genome sequence of Rickettsia conorii subsp. indica, the agent of Indian tick typhus. J Bacteriol. 2012;194:3288–9. DOIPubMedGoogle Scholar
  5. MacConnachie  K, Tishkowski  K. Boutonneuse fever. Treasure Island (FL): StatPearls Publishing; 2022 [cited 2022 Jul 5]. https://www.ncbi.nlm.nih.gov/books/NBK560914
  6. Guo  LP, Jiang  SH, Liu  D, Wang  SW, Chen  CF, Wang  YZ. Emerging spotted fever group rickettsiae in ticks, northwestern China. Ticks Tick Borne Dis. 2016;7:1146–50. DOIPubMedGoogle Scholar
  7. Xu  N, Gai  W, Zhang  Y, Wang  W, Wang  G, Dasch  GA, et al. Confirmation of Rickettsia conorii subspecies indica infection by next-generation sequencing, Shandong, China. Emerg Infect Dis. 2021;27:2691–4. DOIPubMedGoogle Scholar
  8. Qin  XR, Han  HJ, Han  FJ, Zhao  FM, Zhang  ZT, Xue  ZF, et al. Rickettsia japonica and novel Rickettsia species in ticks, China. Emerg Infect Dis. 2019;25:992–5. DOIPubMedGoogle Scholar
  9. Li  F, Zhang  ZT, Fang  LZ, Yu  H, Qin  XR, Yu  XJ. Indoor and outdoor rodent hosts of Orientia tsutsugamushi, Shandong Province, China. Emerg Infect Dis. 2021;27:2731–4. DOIPubMedGoogle Scholar
  10. Liu  JW, Wen  HL, Fang  LZ, Zhang  ZT, He  ST, Xue  ZF, et al. Prevalence of SFTSV among Asian house shrews and rodents, China, January-August 2013. Emerg Infect Dis. 2014;20:2126–8. DOIPubMedGoogle Scholar
  11. Qin  XR, Liu  JW, Yu  H, Yu  XJ. Bartonella species detected in rodents from eastern China. Vector Borne Zoonotic Dis. 2019;19:810–4. DOIPubMedGoogle Scholar
  12. Huang  Y, Zhao  L, Zhang  Z, Liu  M, Xue  Z, Ma  D, et al. Detection of a novel Rickettsia from Leptotrombidium scutellare mites (Acari: Trombiculidae) from Shandong of China. J Med Entomol. 2017;54:544–9. DOIPubMedGoogle Scholar
  13. Yuan  TT, Du  CH, Xia  LY, Que  TC, von Fricken  ME, Jiang  BG, et al. Molecular evidence of Candidatus Rickettsia longicornii and a novel Rickettsia strain from ticks in Southern China. Ticks Tick Borne Dis. 2021;12:101679. DOIPubMedGoogle Scholar
  14. Gray  J, Dantas-Torres  F, Estrada-Peña  A, Levin  M. Systematics and ecology of the brown dog tick, Rhipicephalus sanguineus. Ticks Tick Borne Dis. 2013;4:171–80. DOIPubMedGoogle Scholar
  15. Chen  J, Zou  L, Jin  Z, Ruan  S. Modeling the geographic spread of rabies in China. PLoS Negl Trop Dis. 2015;9:e0003772. DOIPubMedGoogle Scholar

Main Article

Page created: October 17, 2022
Page updated: November 21, 2022
Page reviewed: November 21, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external