Volume 28, Number 12—December 2022
Dispatch
Natural Mediterranean Spotted Fever Foci, Qingdao, China
Table 1
Primers used for amplification of spotted fever group Rickettsia from natural Mediterranean spotted fever foci, Qingdao City, China*
Target gene | Primer | Nucleotide sequence, 5′ → 3′ | Length, bp | Reference |
---|---|---|---|---|
17 kDa antigen | F1 | CATTGTCCGTCAGGTTGGCG | 371 | (12) |
R1 | GGAACACTTCTTGGCGGTG | |||
F2 | AACCGTAATTGCCGTTATCCGG | 214 | ||
R2 |
GCATTACTTGGTTCTCAATTCGG |
|||
16S rRNA | F1 | TGATCCTGGCTCAGAACGAAC | 1,486 | (12) |
R1 | TAAGGAGGTAATCCAGCCGC | |||
F2 | AACACATGCAAGTCGRACGG | 1,371 | ||
R2 |
GGCTGCCTCTTGCGTTAGCT |
|||
Outer membrane protein A | F | ATGGCGAATATTTCTCCAAAA | 536 | (13) |
R |
AGTGCAGCATTCGCTCCCCCT |
|||
Outer membrane protein B | F1 | ATATGCAGGTATCGGTACT | 1,355 | (12) |
R1 | CCATATACCGTAAGCTACAT | |||
F2 | GCAGGTATCGGTACTATAAAC | 843 | ||
R2 | AATTTACGAAACGATTACTTCCGG |
*Samples studied were from rodents collected in Huangdao District, Qingdao, China, during July–October every year in 2013–2015. The rodent collection was described in a previous study (11). F, forward; R, reverse.
References
- Colomba C, Saporito L, Polara VF, Rubino R, Titone L. Mediterranean spotted fever: clinical and laboratory characteristics of 415 Sicilian children. BMC Infect Dis. 2006;6:60. DOIPubMedGoogle Scholar
- Rovery C, Brouqui P, Raoult D. Questions on Mediterranean spotted fever a century after its discovery. Emerg Infect Dis. 2008;14:1360–7. DOIPubMedGoogle Scholar
- Sentausa E, El Karkouri K, Robert C, Raoult D, Fournier PE. Genome sequence of Rickettsia conorii subsp. indica, the agent of Indian tick typhus. J Bacteriol. 2012;194:3288–9. DOIPubMedGoogle Scholar
- MacConnachie K, Tishkowski K. Boutonneuse fever. Treasure Island (FL): StatPearls Publishing; 2022 [cited 2022 Jul 5]. https://www.ncbi.nlm.nih.gov/books/NBK560914
- Guo LP, Jiang SH, Liu D, Wang SW, Chen CF, Wang YZ. Emerging spotted fever group rickettsiae in ticks, northwestern China. Ticks Tick Borne Dis. 2016;7:1146–50. DOIPubMedGoogle Scholar
- Xu N, Gai W, Zhang Y, Wang W, Wang G, Dasch GA, et al. Confirmation of Rickettsia conorii subspecies indica infection by next-generation sequencing, Shandong, China. Emerg Infect Dis. 2021;27:2691–4. DOIPubMedGoogle Scholar
- Qin XR, Han HJ, Han FJ, Zhao FM, Zhang ZT, Xue ZF, et al. Rickettsia japonica and novel Rickettsia species in ticks, China. Emerg Infect Dis. 2019;25:992–5. DOIPubMedGoogle Scholar
- Li F, Zhang ZT, Fang LZ, Yu H, Qin XR, Yu XJ. Indoor and outdoor rodent hosts of Orientia tsutsugamushi, Shandong Province, China. Emerg Infect Dis. 2021;27:2731–4. DOIPubMedGoogle Scholar
- Liu JW, Wen HL, Fang LZ, Zhang ZT, He ST, Xue ZF, et al. Prevalence of SFTSV among Asian house shrews and rodents, China, January-August 2013. Emerg Infect Dis. 2014;20:2126–8. DOIPubMedGoogle Scholar
- Qin XR, Liu JW, Yu H, Yu XJ. Bartonella species detected in rodents from eastern China. Vector Borne Zoonotic Dis. 2019;19:810–4. DOIPubMedGoogle Scholar
- Huang Y, Zhao L, Zhang Z, Liu M, Xue Z, Ma D, et al. Detection of a novel Rickettsia from Leptotrombidium scutellare mites (Acari: Trombiculidae) from Shandong of China. J Med Entomol. 2017;54:544–9. DOIPubMedGoogle Scholar
- Yuan TT, Du CH, Xia LY, Que TC, von Fricken ME, Jiang BG, et al. Molecular evidence of Candidatus Rickettsia longicornii and a novel Rickettsia strain from ticks in Southern China. Ticks Tick Borne Dis. 2021;12:
101679 . DOIPubMedGoogle Scholar - Gray J, Dantas-Torres F, Estrada-Peña A, Levin M. Systematics and ecology of the brown dog tick, Rhipicephalus sanguineus. Ticks Tick Borne Dis. 2013;4:171–80. DOIPubMedGoogle Scholar
- Chen J, Zou L, Jin Z, Ruan S. Modeling the geographic spread of rabies in China. PLoS Negl Trop Dis. 2015;9:
e0003772 . DOIPubMedGoogle Scholar