Volume 28, Number 12—December 2022
Dispatch
Natural Mediterranean Spotted Fever Foci, Qingdao, China
Table 1
Primers used for amplification of spotted fever group Rickettsia from natural Mediterranean spotted fever foci, Qingdao City, China*
| Target gene | Primer | Nucleotide sequence, 5′ → 3′ | Length, bp | Reference |
|---|---|---|---|---|
| 17 kDa antigen | F1 | CATTGTCCGTCAGGTTGGCG | 371 | (12) |
| R1 | GGAACACTTCTTGGCGGTG | |||
| F2 | AACCGTAATTGCCGTTATCCGG | 214 | ||
| R2 |
GCATTACTTGGTTCTCAATTCGG |
|||
| 16S rRNA | F1 | TGATCCTGGCTCAGAACGAAC | 1,486 | (12) |
| R1 | TAAGGAGGTAATCCAGCCGC | |||
| F2 | AACACATGCAAGTCGRACGG | 1,371 | ||
| R2 |
GGCTGCCTCTTGCGTTAGCT |
|||
| Outer membrane protein A | F | ATGGCGAATATTTCTCCAAAA | 536 | (13) |
| R |
AGTGCAGCATTCGCTCCCCCT |
|||
| Outer membrane protein B | F1 | ATATGCAGGTATCGGTACT | 1,355 | (12) |
| R1 | CCATATACCGTAAGCTACAT | |||
| F2 | GCAGGTATCGGTACTATAAAC | 843 | ||
| R2 | AATTTACGAAACGATTACTTCCGG |
*Samples studied were from rodents collected in Huangdao District, Qingdao, China, during July–October every year in 2013–2015. The rodent collection was described in a previous study (11). F, forward; R, reverse.
References
- Colomba C, Saporito L, Polara VF, Rubino R, Titone L. Mediterranean spotted fever: clinical and laboratory characteristics of 415 Sicilian children. BMC Infect Dis. 2006;6:60. DOIPubMedGoogle Scholar
- Rovery C, Brouqui P, Raoult D. Questions on Mediterranean spotted fever a century after its discovery. Emerg Infect Dis. 2008;14:1360–7. DOIPubMedGoogle Scholar
- Sentausa E, El Karkouri K, Robert C, Raoult D, Fournier PE. Genome sequence of Rickettsia conorii subsp. indica, the agent of Indian tick typhus. J Bacteriol. 2012;194:3288–9. DOIPubMedGoogle Scholar
- MacConnachie K, Tishkowski K. Boutonneuse fever. Treasure Island (FL): StatPearls Publishing; 2022 [cited 2022 Jul 5]. https://www.ncbi.nlm.nih.gov/books/NBK560914
- Guo LP, Jiang SH, Liu D, Wang SW, Chen CF, Wang YZ. Emerging spotted fever group rickettsiae in ticks, northwestern China. Ticks Tick Borne Dis. 2016;7:1146–50. DOIPubMedGoogle Scholar
- Xu N, Gai W, Zhang Y, Wang W, Wang G, Dasch GA, et al. Confirmation of Rickettsia conorii subspecies indica infection by next-generation sequencing, Shandong, China. Emerg Infect Dis. 2021;27:2691–4. DOIPubMedGoogle Scholar
- Qin XR, Han HJ, Han FJ, Zhao FM, Zhang ZT, Xue ZF, et al. Rickettsia japonica and novel Rickettsia species in ticks, China. Emerg Infect Dis. 2019;25:992–5. DOIPubMedGoogle Scholar
- Li F, Zhang ZT, Fang LZ, Yu H, Qin XR, Yu XJ. Indoor and outdoor rodent hosts of Orientia tsutsugamushi, Shandong Province, China. Emerg Infect Dis. 2021;27:2731–4. DOIPubMedGoogle Scholar
- Liu JW, Wen HL, Fang LZ, Zhang ZT, He ST, Xue ZF, et al. Prevalence of SFTSV among Asian house shrews and rodents, China, January-August 2013. Emerg Infect Dis. 2014;20:2126–8. DOIPubMedGoogle Scholar
- Qin XR, Liu JW, Yu H, Yu XJ. Bartonella species detected in rodents from eastern China. Vector Borne Zoonotic Dis. 2019;19:810–4. DOIPubMedGoogle Scholar
- Huang Y, Zhao L, Zhang Z, Liu M, Xue Z, Ma D, et al. Detection of a novel Rickettsia from Leptotrombidium scutellare mites (Acari: Trombiculidae) from Shandong of China. J Med Entomol. 2017;54:544–9. DOIPubMedGoogle Scholar
- Yuan TT, Du CH, Xia LY, Que TC, von Fricken ME, Jiang BG, et al. Molecular evidence of Candidatus Rickettsia longicornii and a novel Rickettsia strain from ticks in Southern China. Ticks Tick Borne Dis. 2021;12:
101679 . DOIPubMedGoogle Scholar - Gray J, Dantas-Torres F, Estrada-Peña A, Levin M. Systematics and ecology of the brown dog tick, Rhipicephalus sanguineus. Ticks Tick Borne Dis. 2013;4:171–80. DOIPubMedGoogle Scholar
- Chen J, Zou L, Jin Z, Ruan S. Modeling the geographic spread of rabies in China. PLoS Negl Trop Dis. 2015;9:
e0003772 . DOIPubMedGoogle Scholar
Page created: October 17, 2022
Page updated: November 21, 2022
Page reviewed: November 21, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.