Volume 28, Number 5—May 2022
Dispatch
Novel Hendra Virus Variant Circulating in Black Flying Foxes and Grey-Headed Flying Foxes, Australia
Table 1
Primers and probes used in PCR for study of novel Hendra virus variant circulating in black and grey-headed flying foxes, Australia*
Target | Primers and Probes | Reference |
---|---|---|
HeV-g1 P gene | F: 5′-CCCAACCAAGAAAGCAAGAG | This study |
R: 5′-TTCATTCCTCGTGACAGCAC | ||
P: 5′-TTACTGCGGAGAATGTCCAACTGAGTG |
||
HeV-g1 M gene | F: 5′-CTTCGACAAAGACGGAACCAA | (2) |
R: 5′ TGGCATCTTTCATGCTCCATCTCGG | ||
P: 5′ CCAGCTCGTCGGACAAAATT |
||
HeV-g2 M gene | F: 5′ TCTCGACAAGGACGGAGCTAA | (3) |
R: 5′ CCGGCTCGTCGAACAAAATT | ||
P: 5′ TGGCATCCTTCATGCTTCACCTTGG |
||
Partial cytochrome b gene | F: 5′-CGAAGCTTGATATGAAAAACCATCGTTG | (10,11) |
R: 5′ AACTGCAGCCCCTCAGAATGATATTTGTCCTCA |
||
*F, forward; R, reverse; P, probe. |
References
- Playford EG, McCall B, Smith G, Slinko V, Allen G, Smith I, et al. Human Hendra virus encephalitis associated with equine outbreak, Australia, 2008. Emerg Infect Dis. 2010;16:219–23. DOIPubMedGoogle Scholar
- Field H, Jordan D, Edson D, Morris S, Melville D, Parry-Jones K, et al. Spatiotemporal aspects of Hendra virus infection in pteropid bats (flying-foxes) in eastern Australia. PLoS One. 2015;10:
e0144055 . DOIPubMedGoogle Scholar - Tong S, Chern S-WW, Li Y, Pallansch MA, Anderson LJ. Sensitive and broadly reactive reverse transcription-PCR assays to detect novel paramyxoviruses. J Clin Microbiol. 2008;46:2652–8. DOIPubMedGoogle Scholar
- Wang J, Anderson DE, Halpin K, Hong X, Chen H, Walker S, et al. A new Hendra virus genotype found in Australian flying foxes. Virol J. 2021;18:197. DOIPubMedGoogle Scholar
- Edson D, Field H, McMichael L, Vidgen M, Goldspink L, Broos A, et al. Routes of Hendra virus excretion in naturally-infected flying-foxes: implications for viral transmission and spillover risk. PLoS One. 2015;10:
e0140670 . DOIPubMedGoogle Scholar - Smith I, Broos A, de Jong C, Zeddeman A, Smith C, Smith G, et al. Identifying Hendra virus diversity in pteropid bats. PLoS One. 2011;6:
e25275 . DOIPubMedGoogle Scholar - Plowright RK, Eby P, Hudson PJ, Smith IL, Westcott D, Bryden WL, et al. Ecological dynamics of emerging bat virus spillover. Proc Biol Sci. 2015;282:
20142124 . DOIPubMedGoogle Scholar - Lunney D, Richards G. Dickman C Pteropus poliocephalus. The IUCN Red List of Threatened Species [cited 2021 Nov 15]. https://www.iucnredlist.org/species/18751/22085511
1These authors contributed equally to this article.
2These senior authors contributed equally to this article.
3Members of Bat One Health are listed at the end of this article.
Page created: March 07, 2022
Page updated: April 19, 2022
Page reviewed: April 19, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.