Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 28, Number 5—May 2022

Dispatch

Novel Hendra Virus Variant Circulating in Black Flying Foxes and Grey-Headed Flying Foxes, Australia

Alison J. Peel1Comments to Author , Claude Kwe Yinda1, Edward J. Annand, Adrienne S. Dale, Peggy Eby, John-Sebastian Eden, Devin N. Jones, Maureen K. Kessler, Tamika J. Lunn, Tim Pearson, Jonathan E. Schulz, Ina L. Smith, Vincent J. Munster2, Raina K. Plowright2, and Bat One Health Group3
Author affiliations: Griffith University Centre for Planetary Health and Food Security, Nathan, Queensland, Australia (A.J. Peel, P. Eby, T.J. Lunn); National Institutes of Health, Hamilton, Montana, USA (C.K. Yinda, J.E. Schulz, V.J. Munster); EquiEpiVet, Aireys Inlet, Victoria, Australia (E.J. Annand); Department of Agriculture, Water, and the Environment, Canberra, Australian Capital Territory, Australia (E.J. Annand); University of Sydney, Sydney, New South Wales, Australia (E.J. Annand, J.-S. Eden); Texas Tech University, Lubbock, Texas, USA (A.S. Dale); University of New South Wales, Sydney (P. Eby); Montana State University, Bozeman, Montana, USA (D.N. Jones, M.K. Kessler, R.K. Plowright); Bellingen, New South Wales, Australia (T. Pearson); CSIRO, Black Mountain, Australian Capital Territory, Australia (I.L. Smith)

Main Article

Table 1

Primers and probes used in PCR for study of novel Hendra virus variant circulating in black and grey-headed flying foxes, Australia*

Target Primers and Probes Reference
HeV-g1 P gene F: 5′-CCCAACCAAGAAAGCAAGAG This study
R: 5′-TTCATTCCTCGTGACAGCAC

P: 5′-TTACTGCGGAGAATGTCCAACTGAGTG

HeV-g1 M gene F: 5′-CTTCGACAAAGACGGAACCAA (2)
R: 5′ TGGCATCTTTCATGCTCCATCTCGG

P: 5′ CCAGCTCGTCGGACAAAATT

HeV-g2 M gene F: 5′ TCTCGACAAGGACGGAGCTAA (3)
R: 5′ CCGGCTCGTCGAACAAAATT

P: 5′ TGGCATCCTTCATGCTTCACCTTGG

Partial cytochrome b gene F: 5′-CGAAGCTTGATATGAAAAACCATCGTTG (10,11)

R: 5′ AACTGCAGCCCCTCAGAATGATATTTGTCCTCA

*F, forward; R, reverse; P, probe.

Main Article

References
  1. Playford  EG, McCall  B, Smith  G, Slinko  V, Allen  G, Smith  I, et al. Human Hendra virus encephalitis associated with equine outbreak, Australia, 2008. Emerg Infect Dis. 2010;16:219–23. DOIPubMedGoogle Scholar
  2. Smith  IL, Halpin  K, Warrilow  D, Smith  GA. Development of a fluorogenic RT-PCR assay (TaqMan) for the detection of Hendra virus. J Virol Methods. 2001;98:33–40. DOIPubMedGoogle Scholar
  3. Annand  EJ, Horsburgh  BA, Xu  K, Reid  PA, Poole  B, de Kantzow  MC, et al. Novel Hendra virus variant detected by sentinel surveillance of Australian horses. Emerg Infect Dis. 2022;28:693–704. DOIPubMedGoogle Scholar
  4. Field  H, Jordan  D, Edson  D, Morris  S, Melville  D, Parry-Jones  K, et al. Spatiotemporal aspects of Hendra virus infection in pteropid bats (flying-foxes) in eastern Australia. PLoS One. 2015;10:e0144055. DOIPubMedGoogle Scholar
  5. ProMED. Hendra virus spillover [cited 2021 Oct 20]. https://promedmail.org, archive no. 8699079.
  6. Tong  S, Chern  S-WW, Li  Y, Pallansch  MA, Anderson  LJ. Sensitive and broadly reactive reverse transcription-PCR assays to detect novel paramyxoviruses. J Clin Microbiol. 2008;46:2652–8. DOIPubMedGoogle Scholar
  7. Wang  J, Anderson  DE, Halpin  K, Hong  X, Chen  H, Walker  S, et al. A new Hendra virus genotype found in Australian flying foxes. Virol J. 2021;18:197. DOIPubMedGoogle Scholar
  8. Edson  D, Field  H, McMichael  L, Vidgen  M, Goldspink  L, Broos  A, et al. Routes of Hendra virus excretion in naturally-infected flying-foxes: implications for viral transmission and spillover risk. PLoS One. 2015;10:e0140670. DOIPubMedGoogle Scholar
  9. Smith  I, Broos  A, de Jong  C, Zeddeman  A, Smith  C, Smith  G, et al. Identifying Hendra virus diversity in pteropid bats. PLoS One. 2011;6:e25275. DOIPubMedGoogle Scholar
  10. Kocher  TD, Thomas  WK, Meyer  A, Edwards  SV, Pääbo  S, Villablanca  FX, et al. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc Natl Acad Sci U S A. 1989;86:6196–200. DOIPubMedGoogle Scholar
  11. Hsieh  H-M, Chiang  H-L, Tsai  L-C, Lai  S-Y, Huang  N-E, Linacre  A, et al. Cytochrome b gene for species identification of the conservation animals. Forensic Sci Int. 2001;122:7–18. DOIPubMedGoogle Scholar
  12. Plowright  RK, Eby  P, Hudson  PJ, Smith  IL, Westcott  D, Bryden  WL, et al. Ecological dynamics of emerging bat virus spillover. Proc Biol Sci. 2015;282:20142124. DOIPubMedGoogle Scholar
  13. Lunney  D, Richards  G. Dickman C Pteropus poliocephalus. The IUCN Red List of Threatened Species [cited 2021 Nov 15]. https://www.iucnredlist.org/species/18751/22085511

Main Article

1These authors contributed equally to this article.

2These senior authors contributed equally to this article.

3Members of Bat One Health are listed at the end of this article.

Page created: March 07, 2022
Page updated: April 19, 2022
Page reviewed: April 19, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external