Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 28, Number 9—September 2022

Research

Detection of Endosymbiont Candidatus Midichloria mitochondrii and Tickborne Pathogens in Humans Exposed to Tick Bites, Italy

Giovanni Sgroi1, Roberta Iatta1, Piero Lovreglio, Angela Stufano, Younes Laidoudi, Jairo Alfonso Mendoza-Roldan, Marcos Antonio Bezerra-Santos, Vincenzo Veneziano, Francesco Di Gennaro, Annalisa Saracino, Maria Chironna, Claudio Bandi, and Domenico OtrantoComments to Author 
Author affiliations: University of Bari Aldo Moro, Bari, Italy (G. Sgroi, R. Iatta, P. Lovreglio, A. Stufano, Y. Laidoudi, J.A. Mendoza-Roldan, M.A. Bezerra-Santos, F. Di Gennaro, A. Saracino, M. Chironna, D. Otranto); University of Naples Federico II, Naples, Italy (V. Veneziano); Osservatorio Faunistico Venatorio, Naples (V. Veneziano); University of Milan Statale, Milan, Italy (C. Bandi); Bu-Ali Sina University, Hamedan, Iran (D. Otranto)

Main Article

Table 1

Bacteria investigated by molecular methods in a study on the relationship between endosymbiont Candidatus Midichloria mitochondrii and tickborne pathogens in humans exposed to tick bites, Italy, 2021

Tickborne bacteria Target gene Primers Sequence, 5ˈ → 3ˈ Base pairs Reference
Coxiella burnetii IS1111a Trans1 TATGTATCCACCGTAGCCAGT 687 (21)


Trans2
CCCAACAACACCTCCTTATTC


Rickettsia spp. gltA CS 78F GCAAGTATCGGTGAGGATGTAAT 401 (22)


CS 323R
GCTTCCTTAAAATTCAATAAATCAGGAT


Borrelia burgdorferi sensu lato complex Flagellin FLA1 AGAGCAACTTACAGACGAAATTAAT 482 (23)


FLA2
CAAGTCTATTTTGGAAAGCACCTAA


Anaplasmataceae 16S rRNA EHR 16SD GGTACCYACAGAAGAAGTCC 345 (24)
EHR 16SR TAGCACTCATCGTTTACAGC

Main Article

References
  1. Dantas-Torres  F, Chomel  BB, Otranto  D. Ticks and tick-borne diseases: a One Health perspective. Trends Parasitol. 2012;28:437–46. DOIPubMedGoogle Scholar
  2. Kuehn  B. Tickborne diseases increasing. JAMA. 2019;321:138.PubMedGoogle Scholar
  3. Madison-Antenucci  S, Kramer  LD, Gebhardt  LL, Kauffman  E. Emerging tick-borne diseases. Clin Microbiol Rev. 2020;33:e00083–18. DOIPubMedGoogle Scholar
  4. Mendoza-Roldan  JA, Ravindran Santhakumari Manoj  R, Latrofa  MS, Iatta  R, Annoscia  G, Lovreglio  P, et al. Role of reptiles and associated arthropods in the epidemiology of rickettsioses: A one health paradigm. PLoS Negl Trop Dis. 2021;15:e0009090. DOIPubMedGoogle Scholar
  5. Silva-Rodríguez  EA, Gálvez  N, Swan  GJF, Cusack  JJ, Moreira-Arce  D. Urban wildlife in times of COVID-19: What can we infer from novel carnivore records in urban areas? Sci Total Environ. 2021;765:142713. DOIPubMedGoogle Scholar
  6. Sgroi  G, Iatta  R, Lia  RP, D’Alessio  N, Manoj  RRS, Veneziano  V, et al. Spotted fever group rickettsiae in Dermacentor marginatus from wild boars in Italy. Transbound Emerg Dis. 2021;68:2111–20. DOIPubMedGoogle Scholar
  7. Otranto  D, Dantas-Torres  F, Giannelli  A, Latrofa  MS, Cascio  A, Cazzin  S, et al. Ticks infesting humans in Italy and associated pathogens. Parasit Vectors. 2014;7:328. DOIPubMedGoogle Scholar
  8. Sgroi  G, Iatta  R, Lia  RP, Napoli  E, Buono  F, Bezerra-Santos  MA, et al. Tick exposure and risk of tick-borne pathogens infection in hunters and hunting dogs: a citizen science approach. Transbound Emerg Dis. 2022;69:e386–93. DOIPubMedGoogle Scholar
  9. Santino  I, Cammarata  E, Franco  S, Galdiero  F, Oliva  B, Sessa  R, et al. Multicentric study of seroprevalence of Borrelia burgdorferi and Anaplasma phagocytophila in high-risk groups in regions of central and southern Italy. Int J Immunopathol Pharmacol. 2004;17:219–23. DOIPubMedGoogle Scholar
  10. Toepp  AJ, Willardson  K, Larson  M, Scott  BD, Johannes  A, Senesac  R, et al. Frequent exposure to many hunting dogs significantly increases tick exposure. Vector Borne Zoonotic Dis. 2018;18:519–23. DOIPubMedGoogle Scholar
  11. Jansen  A, La Scola  B, Raoult  D, Lierz  M, Wichmann  O, Stark  K, et al. Antibodies against Rickettsia spp. in hunters, Germany. Emerg Infect Dis. 2008;14:1961–3. DOIPubMedGoogle Scholar
  12. Kmetiuk  LB, Krawczak  FS, Machado  FP, Paploski  IAD, Martins  TF, Teider-Junior  PI, et al. Ticks and serosurvey of anti-Rickettsia spp. antibodies in wild boars (Sus scrofa), hunting dogs and hunters of Brazil. PLoS Negl Trop Dis. 2019;13:e0007405. DOIPubMedGoogle Scholar
  13. Sgroi  G, Varcasia  A, Dessì  G, D’Alessio  N, Pacifico  L, Buono  F, et al. Massive Taenia hydatigena cysticercosis in a wild boar (Sus scrofa) from Italy. Acta Parasitol. 2019;64:938–41. DOIPubMedGoogle Scholar
  14. Stavru  F, Riemer  J, Jex  A, Sassera  D. When bacteria meet mitochondria: The strange case of the tick symbiont Midichloria mitochondrii†. Cell Microbiol. 2020;22:e13189. DOIPubMedGoogle Scholar
  15. Cafiso  A, Sassera  D, Romeo  C, Serra  V, Hervet  C, Bandi  C, et al. Midichloria mitochondrii, endosymbiont of Ixodes ricinus: evidence for the transmission to the vertebrate host during the tick blood meal. Ticks Tick Borne Dis. 2019;10:5–12. DOIPubMedGoogle Scholar
  16. Mariconti  M, Epis  S, Gaibani  P, Dalla Valle  C, Sassera  D, Tomao  P, et al. Humans parasitized by the hard tick Ixodes ricinus are seropositive to Midichloria mitochondrii: is Midichloria a novel pathogen, or just a marker of tick bite? Pathog Glob Health. 2012;106:391–6. DOIPubMedGoogle Scholar
  17. Serra  V, Krey  V, Daschkin  C, Cafiso  A, Sassera  D, Maxeiner  HG, et al. Seropositivity to Midichloria mitochondrii (order Rickettsiales) as a marker to determine the exposure of humans to tick bite. Pathog Glob Health. 2019;113:167–72. DOIPubMedGoogle Scholar
  18. Epis  S, Sassera  D, Beninati  T, Lo  N, Beati  L, Piesman  J, et al. Midichloria mitochondrii is widespread in hard ticks (Ixodidae) and resides in the mitochondria of phylogenetically diverse species. Parasitology. 2008;135:485–94. DOIPubMedGoogle Scholar
  19. Bazzocchi  C, Mariconti  M, Sassera  D, Rinaldi  L, Martin  E, Cringoli  G, et al. Molecular and serological evidence for the circulation of the tick symbiont Midichloria (Rickettsiales: Midichloriaceae) in different mammalian species. Parasit Vectors. 2013;6:350. DOIPubMedGoogle Scholar
  20. Serra  V, Cafiso  A, Formenti  N, Verheyden  H, Plantard  O, Bazzocchi  C, et al. Molecular and serological evidence of the presence of Midichloria mitochondrii in roe deer (Capreolus capreolus) in France. J Wildl Dis. 2018;54:597–600. DOIPubMedGoogle Scholar
  21. Berri  M, Laroucau  K, Rodolakis  A. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol. 2000;72:285–93. DOIPubMedGoogle Scholar
  22. Labruna  MB, Whitworth  T, Horta  MC, Bouyer  DH, McBride  JW, Pinter  A, et al. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol. 2004;42:90–8. DOIPubMedGoogle Scholar
  23. Wójcik-Fatla  A, Szymańska  J, Wdowiak  L, Buczek  A, Dutkiewicz  J. Coincidence of three pathogens (Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti) in Ixodes ricinus ticks in the Lublin macroregion. Ann Agric Environ Med. 2009;16:151–8.PubMedGoogle Scholar
  24. Parola  P, Roux  V, Camicas  JL, Baradji  I, Brouqui  P, Raoult  D. Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans R Soc Trop Med Hyg. 2000;94:707–8. DOIPubMedGoogle Scholar
  25. Nakamura  T, Yamada  KD, Tomii  K, Katoh  K. Parallelization of MAFFT for large-scale multiple sequence alignments. Bioinformatics. 2018;34:2490–2. DOIPubMedGoogle Scholar
  26. Capella-Gutiérrez  S, Silla-Martínez  JM, Gabaldón  T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009;25:1972–3. DOIPubMedGoogle Scholar
  27. Minh  BQ, Schmidt  HA, Chernomor  O, Schrempf  D, Woodhams  MD, von Haeseler  A, et al. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol. 2020;37:1530–4. DOIPubMedGoogle Scholar
  28. Hoang  DT, Chernomor  O, von Haeseler  A, Minh  BQ, Vinh  LS. UFBoot2: improving the ultrafast bootstrap approximation. Mol Biol Evol. 2018;35:518–22. DOIPubMedGoogle Scholar
  29. Kalyaanamoorthy  S, Minh  BQ, Wong  TKF, von Haeseler  A, Jermiin  LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 2017;14:587–9. DOIPubMedGoogle Scholar
  30. Zhang  J, Kapli  P, Pavlidis  P, Stamatakis  A. A general species delimitation method with applications to phylogenetic placements. Bioinformatics. 2013;29:2869–76. DOIPubMedGoogle Scholar
  31. Balaban  M, Sarmashghi  S, Mirarab  S. APPLES: scalable distance-based phylogenetic placement with or without alignments. Syst Biol. 2020;69:566–78. DOIPubMedGoogle Scholar
  32. Letunic  I, Bork  P. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021;49(W1):W293–6. DOIPubMedGoogle Scholar
  33. RStudio Team. RStudio: integrated development for R [cited 2022 Jan 12]. https://www.rstudio.com
  34. Sergeant  ESG. Epitools epidemiological calculators. Ausvet. 2018 [cited 2022 Jan 14]. http://epitools.ausvet.com.au
  35. Körner  S, Makert  GR, Ulbert  S, Pfeffer  M, Mertens-Scholz  K. The prevalence of Coxiella burnetii in hard ticks in Europe and their role in Q fever transmission revisited—a systematic review. Front Vet Sci. 2021;8:655715. DOIPubMedGoogle Scholar
  36. Gürtler  L, Bauerfeind  U, Blümel  J, Burger  R, Drosten  C, Gröner  A, et al. Coxiella burnetii—pathogenic agent of Q (query) fever. Transfus Med Hemother. 2014;41:60–72. DOIPubMedGoogle Scholar
  37. Mediannikov  O, Matsumoto  K, Samoylenko  I, Drancourt  M, Roux  V, Rydkina  E, et al. Rickettsia raoultii sp. nov., a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia. Int J Syst Evol Microbiol. 2008;58:1635–9. DOIPubMedGoogle Scholar
  38. Parola  P, Rovery  C, Rolain  JM, Brouqui  P, Davoust  B, Raoult  D. Rickettsia slovaca and R. raoultii in tick-borne Rickettsioses. Emerg Infect Dis. 2009;15:1105–8. DOIPubMedGoogle Scholar
  39. Li  H, Zhang  PH, Huang  Y, Du  J, Cui  N, Yang  ZD, et al. Isolation and identification of Rickettsia raoultii in human cases: a surveillance study in 3 medical centers in China. Clin Infect Dis. 2018;66:1109–15. DOIPubMedGoogle Scholar
  40. Jia  N, Zheng  YC, Ma  L, Huo  QB, Ni  XB, Jiang  BG, et al. Human infections with Rickettsia raoultii, China. Emerg Infect Dis. 2014;20:866–8. DOIPubMedGoogle Scholar
  41. Mendoza-Roldan  JA, Colella  V, Lia  RP, Nguyen  VL, Barros-Battesti  DM, Iatta  R, et al. Borrelia burgdorferi (sensu lato) in ectoparasites and reptiles in southern Italy. Parasit Vectors. 2019;12:35. DOIPubMedGoogle Scholar
  42. Sgroi  G, Iatta  R, Veneziano  V, Bezerra-Santos  MA, Lesiczka  P, Hrazdilová  K, et al. Molecular survey on tick-borne pathogens and Leishmania infantum in red foxes (Vulpes vulpes) from southern Italy. Ticks Tick Borne Dis. 2021;12:101669. DOIPubMedGoogle Scholar
  43. Collares-Pereira  M, Couceiro  S, Franca  I, Kurtenbach  K, Schäfer  SM, Vitorino  L, et al. First isolation of Borrelia lusitaniae from a human patient. J Clin Microbiol. 2004;42:1316–8. DOIPubMedGoogle Scholar
  44. Aguero-Rosenfeld  ME, Wormser  GP. Lyme disease: diagnostic issues and controversies. Expert Rev Mol Diagn. 2015;15:1–4. DOIPubMedGoogle Scholar
  45. Budachetri  K, Kumar  D, Crispell  G, Beck  C, Dasch  G, Karim  S. The tick endosymbiont Candidatus Midichloria mitochondrii and selenoproteins are essential for the growth of Rickettsia parkeri in the Gulf Coast tick vector. Microbiome. 2018;6:141. DOIPubMedGoogle Scholar
  46. Cafiso  A, Bazzocchi  C, De Marco  L, Opara  MN, Sassera  D, Plantard  O. Molecular screening for Midichloria in hard and soft ticks reveals variable prevalence levels and bacterial loads in different tick species. Ticks Tick Borne Dis. 2016;7:1186–92. DOIPubMedGoogle Scholar
  47. Buysse  M, Duron  O. Multi-locus phylogenetics of the Midichloria endosymbionts reveals variable specificity of association with ticks. Parasitology. 2018;145:1969–78. DOIPubMedGoogle Scholar
  48. Matsumoto  K, Izri  A, Dumon  H, Raoult  D, Parola  P. First detection of Wolbachia spp., including a new genotype, in sand flies collected in Marseille, France. J Med Entomol. 2008;45:466–9. DOIPubMedGoogle Scholar
  49. Fraihi  W, Fares  W, Perrin  P, Dorkeld  F, Sereno  D, Barhoumi  W, et al. An integrated overview of the midgut bacterial flora composition of Phlebotomus perniciosus, a vector of zoonotic visceral leishmaniasis in the Western Mediterranean Basin. PLoS Negl Trop Dis. 2017;11:e0005484. DOIPubMedGoogle Scholar
  50. Dantas-Torres  F, Otranto  D. Best practices for preventing vector-borne diseases in dogs and humans. Trends Parasitol. 2016;32:43–55. DOIPubMedGoogle Scholar

Main Article

1These authors contributed equally to this article.

Page created: July 27, 2022
Page updated: August 19, 2022
Page reviewed: August 19, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external