Volume 29, Number 1—January 2023
Dispatch
Bourbon Virus Transmission, New York, USA
Table 1
Name | Gene target | Sequence, 5′ → 3′ |
---|---|---|
BRBV F† | Polymerase subunit, PB1 | AACCGGCCAATAGGG |
BRBV R | Polymerase subunit, PB1 | TGCCAGTTGGGTAGC |
BRBV PROBE_5Cy5 | /5Cy5/ATGGAGCTG/TAO/CTTTCACTACC/3IAbRQSp/ | |
Bourbon_virus_F1‡ | Polymerase subunit, PB1 | ATTGCTACTCCGTCCATGTTAGTAAG |
Bourbon_virus_R1 | Polymerase subunit, PB1 | CCAGAACTTGGTAGACATTCCAATAAG |
Bourbon_virus_P1_HEX probe | /5HEX/CCCTTGCTG/ZEN/CATCTTCCACCACTTTCACAA/3IABkFQ/ |
*BRBV, Bourbon virus; F, forward; P, probe; PB1, polymerase basic 1; R, reverse. †Primer/probe set developed at Wadsworth Center, New York State Department of Health, based on Bourbon virus (St. Louis strain) (GenBank accession no. MK453528). ‡Primer/probe set developed at TickReport (https://www.tickreport) based on Bourbon virus (original strain) (GenBank accession no. KU708254)
1These authors contributed equally to this article.
Page created: December 09, 2022
Page updated: December 22, 2022
Page reviewed: December 22, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.