Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 29, Number 1—January 2023
Dispatch

Bourbon Virus Transmission, New York, USA

Alan P. Dupuis1Comments to Author , Melissa A. Prusinski1, Collin O’Connor, Joseph G. Maffei, Cheri A. Koetzner, Tela E. Zembsch, Steven D. Zink, Alexis L. White, Michael P. Santoriello, Christopher L. Romano, Guang Xu, Fumiko Ribbe, Scott R. Campbell, Stephen M. Rich, P. Bryon Backenson, Laura D. Kramer, and Alexander T. Ciota
Author affiliations: New York State Department of Health, Slingerlands, New York, USA (A.P. Dupuis II, J.G. Maffei, C.A. Koetzner, S.D. Zink, L.D. Kramer, A.T. Ciota); New York State Department of Health, Albany, New York, USA (M.A. Prusinski, C. O’Connor, T.E. Zembsch, P.B. Backenson); Suffolk County Department of Health Services, Yaphank, New York, USA (A.L. White, M.P. Santoriello, C.L. Romano, S.R. Campbell); University of Massachusetts, Amherst, Massachusetts, USA (G. Xu, F. Ribbe, S.M. Rich); State University of New York at Albany School of Public Health, Albany (L.D. Kramer, A.T. Ciota)

Main Article

Table 1

Primer/probe sets for detection of Bourbon virus RNA in New York, NY, USA*

Name Gene target Sequence, 5′ → 3′
BRBV F† Polymerase subunit, PB1 AACCGGCCAATAGGG
BRBV R Polymerase subunit, PB1 TGCCAGTTGGGTAGC
BRBV PROBE_5Cy5 /5Cy5/ATGGAGCTG/TAO/CTTTCACTACC/3IAbRQSp/
Bourbon_virus_F1‡ Polymerase subunit, PB1 ATTGCTACTCCGTCCATGTTAGTAAG
Bourbon_virus_R1 Polymerase subunit, PB1 CCAGAACTTGGTAGACATTCCAATAAG
Bourbon_virus_P1_HEX probe /5HEX/CCCTTGCTG/ZEN/CATCTTCCACCACTTTCACAA/3IABkFQ/

*BRBV, Bourbon virus; F, forward; P, probe; PB1, polymerase basic 1; R, reverse. †Primer/probe set developed at Wadsworth Center, New York State Department of Health, based on Bourbon virus (St. Louis strain) (GenBank accession no. MK453528). ‡Primer/probe set developed at TickReport (https://www.tickreport) based on Bourbon virus (original strain) (GenBank accession no. KU708254)

Main Article

1These authors contributed equally to this article.

Page created: December 09, 2022
Page updated: December 22, 2022
Page reviewed: December 22, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external