Skip directly to page options Skip directly to A-Z link

Volume 31, Number 2—February 2025

Dispatch

Eastern Africa Origin of SAT2 Topotype XIV Foot-and-Mouth Disease Virus Outbreaks, Western Asia, 2023

Antonello Di NardoComments to Author , Andrew E. Shaw, Mathilde Gondard, Jemma Wadsworth, Guillaume Girault, Krupali Parekh, Anna Ludi, Valerie Mioulet, Cindy Bernelin-Cottet, Hayley M. Hicks, Noemi Polo, Abdulnaci Bulut, Unal Parlak, Daniel Gizaw, Mustafa Ababneh, Maisa Al Ameer, Layth M.S. Abdulrasool, Fajur S. Al Saloom, Wafa A. Al-Rawahi, Nick J. Knowles, Labib Bakkali-Kassimi, and Donald P. King
Author affiliation: The Pirbright Institute, Pirbright, UK (A. Di Nardo, A.E. Shaw, J. Wadsworth, K. Parekh, A. Ludi, V. Mioulet, H.M. Hicks, N. Polo, N.J. Knowles, D.P. King); ANSES Laboratory for Animal Health, Maisons-Alfort, France (M. Gondard, G. Girault, C. Bernelin-Cottet, L. Bakkali-Kassimi); Foot and Mouth Disease Institute, Ankara, Turkey (A. Bulut, U. Parlak); Animal Health Institute, Sebeta, Ethiopia (D. Gizaw); Jordan University of Science and Technology, Irbid, Jordan (M. Ababneh); Animal Health Laboratory Directorate, Amman, Jordan (M. Al Ameer); Central Veterinary Laboratories, Baghdad, Iraq (L.M.S. Abdulrasool); Ministry of Municipalities Affairs and Agriculture, Hawrat A'ali, Bahrain (F.S. Al Saloom); Sultan Qaboos University, Muscat, Oman (W.A. Al-Rawahi); Central Laboratory of Animal Health, Muscat (W.A. Al-Rawahi)

Main Article

Table

Primers and probes designed for SAT2/XIV topotype-specific real-time reverse transcription PCR in study of east Africa origin of SAT2 topotype XIV foot-and-mouth disease virus outbreaks, western Asia, 2023*

Oligo name Nucleotide sequence, 5′ → 3′ Genome location Use
SAT2_XIV_AS_P CCTCCACTGCCATCCGCGGTGAYAGG 3663–3688 Probe
SAT_XIV_AS_F ACCGTGTACAACGGTGAGTG 3629–3648 Forward primer
SAT2_XIV_AS_R TCAGCGTACTTGGCCRCAAG 3714–3695 Reverse primer

*FMDV genome locations are based on the ETH/2/2002 full genome sequence (GenBank accession no. OQ557397).

Main Article

Page created: December 10, 2024
Page updated: January 31, 2025
Page reviewed: January 31, 2025
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external