Volume 31, Number 9—September 2025
Research
Detection of Multiple Nosocomial Trichosporon asahii Transmission Events via Microsatellite Typing Assay, South America
Table
Microsatellite typing panel used for detection of multiple nosocomial Trichosporon asahii transmission events via microsatellite typing assay, South America*
| Accession no. | Contig; reference code† | Expected size; total fragment, bp‡ | Repeat unit | D value; no. alleles | Forward primer, 5′ → 3′ | Reverse primer, 5′ → 3′ |
|---|---|---|---|---|---|---|
| CP116786 |
6; E |
173; 206 |
CA |
0.8280; 12 |
FLU-TCGTCTGTCATCGACCCATA |
GGCTCAGCTGAAGCTCACTT |
| CP116785 |
5; G |
123; 153 |
GA |
0.7731; 11 |
FLU-TCCCTTTGATTTGGGTGTGT |
CTCTCCCAGGTTCGTTTCAA |
| CP116781 |
1; I |
183; 211 |
TG |
0.7481; 9 |
FLU-AGCCTTAGTTGCCCTTGTCA |
ACTCAACACTTGGGCGACTT |
| CP116782 |
2; K |
139; 165 |
AG |
0.7666; 10 |
GATCGAGTCCAAGGAACGAC |
FLU-TTCCCGTCCACCTTTACTGA |
| CP116785 |
5; P |
112; 158 |
TCGT |
0.6600; 14 |
FLU-ACGAACTCCATGGCTGAGTC |
TGACTGACAACACACCCGATA |
| CP116785 | 5; Q | 135; 169 | GTT | 0.6452; 12 | FLU-ATCTCGGTTGTTGCCGTTAT | GCAACAGCAACAGCAGTACC |
*Isolates sourced from CBS culture collection (https://wi.knaw.nl/fungal_table) hosted by the Westerdijk Fungal Biodiversity Institute, Utrecht, the Netherlands. Discriminatory power of microsatellite typing panel assay as determined via the Simpson index of diversity (D). FLU, fluorescein. †de novo assembly contig number; microsatellite panel reference code. ‡The expected fragment size without the repeat units; number of alleles refers to the total fragment size of the T. asahii type strain CBS 2479.
Page created: June 18, 2025
Page updated: August 26, 2025
Page reviewed: August 26, 2025
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.