Volume 2, Number 3—July 1996
Dispatch
HIV-1 Group O Virus Identified for the First Time in the United States
Figure 2

Figure 2. Alignment of deduced amino acid sequences of the env C2V3 region of the CDC7755 strain with those of three representative Group O Cameroonian strains (ANT70C, MVP5180 and FR.VAU). The CONS-O represents the consensus amino acid sequence derived from the four strains presented in this alignment. (?) represents positions where a consensus could not be derived. (-) indicates identical amino acids with the CONS-O and (*) indicates gaps (insertion\deletions) that were introduced to align the sequences. NOTE: This table may not fit on page unless printed in landscape mode.
1Primers: gag/outer/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/outer/ reversed - CCTACTCCCTGACAGGCCGT CAGCATTTCTTC; gag/inner/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/inner/reverse - CCTTAAGCTTTTGT AGAATCTATCTACATA; protease/outer/forward - TTTGCCTCCCTCAAATC; protease/outer/reverse - TTACTGGCACTG GGGCTATGG; protease/inner/ forward - CCTCAAATCCCTCTTTG; protease/inner/reverse - TATAGGGAAGTTTAGTGTACA; env/outer/forward - CACAGAATTTAATGGAACAGGC; env/outer/reverse - TGTGTT ACAATAAAAGAATTCTCC; env/inner/forward - GTTACTTGTACACATGGCAT; and env/inner/reverse - AGAATTCTCCATGACAGTTAAA.