Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 2, Number 3—July 1996
Dispatch

HIV-1 Group O Virus Identified for the First Time in the United States

M. A. Rayfield*, P. Sullivan†, C. I. Bandea*, L. Britvan‡, R. A. Otten*, C. P. Pau*, D. Pieniazek*, S. Subbarao*, P. Simon†, C. A. Schable*, A. C. Wright*, J. Ward†, and G. Schochetman*
Author affiliations: Author Affiliations: ; *National Center for Infectious Diseases; †National Center for HIV, STD and TB Prevention, Centers for Disease Control and Prevention, Atlanta, Georgia, USA; ‡Kaiser Permanente Medical Group, Los Angeles, California, USA

Main Article

Figure 2

Alignment of deduced amino acid sequences of the env C2V3 region of the CDC7755 strain with those of three representative Group O Cameroonian strains (ANT70C, MVP5180 and FR.VAU). The CONS-O represents the consensus amino acid sequence derived from the four strains presented in this alignment. (?) represents positions where a consensus could not be derived. (-) indicates identical amino acids with the CONS-O and (*) indicates gaps (insertion\deletions) that were introduced to align the sequences

Figure 2. Alignment of deduced amino acid sequences of the env C2V3 region of the CDC7755 strain with those of three representative Group O Cameroonian strains (ANT70C, MVP5180 and FR.VAU). The CONS-O represents the consensus amino acid sequence derived from the four strains presented in this alignment. (?) represents positions where a consensus could not be derived. (-) indicates identical amino acids with the CONS-O and (*) indicates gaps (insertion\deletions) that were introduced to align the sequences. 
NOTE: This table may not fit on page unless printed in landscape mode.

Main Article

1Primers: gag/outer/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/outer/ reversed - CCTACTCCCTGACAGGCCGT CAGCATTTCTTC; gag/inner/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/inner/reverse - CCTTAAGCTTTTGT AGAATCTATCTACATA; protease/outer/forward - TTTGCCTCCCTCAAATC; protease/outer/reverse - TTACTGGCACTG GGGCTATGG; protease/inner/ forward - CCTCAAATCCCTCTTTG; protease/inner/reverse - TATAGGGAAGTTTAGTGTACA; env/outer/forward - CACAGAATTTAATGGAACAGGC; env/outer/reverse - TGTGTT ACAATAAAAGAATTCTCC; env/inner/forward - GTTACTTGTACACATGGCAT; and env/inner/reverse - AGAATTCTCCATGACAGTTAAA.

Page created: December 20, 2010
Page updated: December 20, 2010
Page reviewed: December 20, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external