Volume 11, Number 5—May 2005
Research
Low Diversity of Alkhurma Hemorrhagic Fever Virus, Saudi Arabia, 1994–1999
Table 2
Positions of primers used for PCR amplification and sequencing of AHFV genome and resulting sequences*
| Primer name | Sequence | Position, per AHFV prototype sequence | PCR product size (bp) | Sequence used for analysis† |
|---|---|---|---|---|
| ALK-ES | GGATATGTGTATGATGTCAATAA | 1342–1364 | 742 | 699 |
| ALK-ER | GCTGCAGTTCAACGAAACCT | 2083–2064 | ||
| ALK-NS3S | CAATGAAGCTTATGTTAGTAGC | 5064–5085 | 757 | 713 |
| ALK-NS3R | CACAAAATCTGGCTTCTCTTCT | 5820–5799 | ||
| ALK-NS5S | AGCAAATCCTGCGTTATCTGA | 9308–9328 | 723 | 685 |
| ALK-NS5R | GTCCCTGCGGGACCCAG | 10030–10014 |
*AHFV, Alkhurma hemorrhagic fever virus; PCR, polymerase chain reaction.
†Primers excluded.
Page created: April 24, 2012
Page updated: April 24, 2012
Page reviewed: April 24, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.