Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 14, Number 9—September 2008
Research

Circulation of 3 Lineages of a Novel Saffold Cardiovirus in Humans

Ana Maria Bispo de Filippis, Luciano Kleber de Souza Luna, Andreas Stöcker, Patrícia Silva Almeida, Tereza Cristina Medrado Ribeiro, Nadine Petersen, Petra Herzog, Célia Pedroso, Hans Iko Huppertz, Hugo da Costa Ribeiro, Sigrid Baumgarte, and Sung Sup ParkComments to Author 
Author affiliations: Federal University of Bahia, Salvador, Brazil (J.F. Drexler, A. Stöcker, P. Silva Almeida, T.C. Medrado Ribeiro, C. Pedroso, H. da Costa Ribeiro Jr.); Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany (J.F. Drexler, L.K. de Souza Luna, N. Petersen, P. Herzog); Professor Hess Paediatric Hospital, Bremen, Germany (H.I. Huppertz); Institute of Hygiene and the Environment, Hamburg (S. Baumgarte); University of Bonn Medical Centre, Bonn, Germany (C. Drosten);

Main Article

Table 1

PCR oligonucleotides and formulations for cardiovirus screening*

ID no. Sequence (5′ → 3′) Position† Orientation Usage
CF188 CTAATCAGAGGAAAGTCAGCAT 188–209 + Nested RT-PCR, 1st round‡
CF204 CAGCATTTTCCGGCCCAGGCTAA 204–226 + Nested RT-PCR, 2nd round§
CR718 GCTATTGTGAGGTCGCTACAGCTGT 718–742 – Nested RT-PCR, 2nd round§
CR990 GACCACTTGGTTTGGAGAAGCT 990–1011 – Nested RT-PCR, 1st round‡
CF723 TGTAGCGACCTCACAGTAGCA 723–743 + Real-time PCR¶
CR888 CAGGACATTCTTGGCTTCTCTA 888–909 – Real-time PCR¶
CP797 FAM-AGATCCACTGCTGTGAGCGGTGCAA-BHQ1 797–821 + (probe) Real-time PCR¶

*ID, identification; RT-PCR, reverse transcription–PCR; FAM, 6-carboxyfluorescein; BHQ1, black hole quencher 1.
†Relative to Saffold virus EF165067 genome.
‡25-µL reactions used the QIAGEN OneStep RT-PCR kit (QIAGEN, Hilden, Germany), with 400 nmol/L each of 1st-round primers CF188 and CR990, 1 µL enzyme mix, 1 µg bovine serum albumin, and 5 µL RNA extract. Amplification involved 30 min at 50°C; 15 min at 95°C; 10 cycles of 20 s at 94°C, 30 s starting at 60°C with a decrease of 1°C per cycle, and 50 s at 72°C; and 40 cycles of 20 s at 95°C, 30 s at 54°C, and 50 s at 72°C with a final elongation step of 5 min at 72°C.
§50-µL reactions used 1 µL of 1st-round PCR product, with 1x Platinum Taq buffer (Invitrogen, Karlsruhe, Germany), 200 µmol/L deoxynucleoside triphosphates each, 2.5 mmol/L MgCl2, 400 nmol/L each of 2nd-round primers CF204 and CR718, and 1 U Platinum Taq polymerase. Amplification involved 3 min at 94°C and 45 cycles of 20 s at 94°C, 30 s at 60°C, and 40 s at 72°C.
¶25-µL reactions used 3 µL of RNA extract, 1x reaction buffer and enzymes from the QIAGEN OneStep RT-PCR kit, 600 nM of primer CF723, 400 nM of primer CR888, and 160 nM of probe CP797. Cycling in an Applied Biosystems 7700 SDS instrument involved the following steps: 55°C for 15 min, 95°C for 15 min, and 45 cycles of 95°C for 15 s/58°C for 30 s.

Main Article

Page created: July 13, 2010
Page updated: July 13, 2010
Page reviewed: July 13, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external