Volume 15, Number 11—November 2009
Letter
Rickettsia massiliae in the Canary Islands
Table
Rickettsia massiliae PCR conditions and amplicon size, Canary Islands, 2008*
Gene | Description (GenBank accession no.) | Primer sequence (5′ → 3′) | Amplicon size, bp | PCR annealing conditions |
---|---|---|---|---|
16S rRNA | 16S ribosomal RNA (GQ144453) | F: AGAGTTTGATCCTGGCTCAG R: AACGTCATTATCTTCCTTGC | 416 | 50°C/30 s |
ompB | Outer membrane protein (GQ144450) | F: GGGTGCTGCTACACAGCAGAA R: CCGTCACCGATATTAATTGCC | 618 | 53°C/30 s |
dnaK | Heat-shock protein 70 (GQ144451) | F: AGCGTCAAGCAACGAAAGAT R: CAAACGTTGAAGTGCTAAAGG | 323 | 50°C/30 s |
dnaA | Chromosomal replication initiation protein (GQ144449) | F: CCTACTAACTTTGTTAGAGATT R: TGATGATTCTGCAACCGCTC | 241 | 56°C/30 s |
recA | RecA recombination protein (GQ144452) | F: TGCTTTTATTGATGCCGAGC R: CTTTAATGGAGCCGATTCTTC | 428 | 52°C/30 s |
atpA | ATP synthase F1 alpha subunit (GQ144448) | F: ACATATCGAGATGAAGGCTCC R: CCGAAATACCGACATTAACG | 731 | 48°C/30 s |
*GenBank accession numbers correspond to R. massiliae sequences identified in this study. PCRs were completed by employing the Access RT-PCR system (Promega, Madison, WI, USA) with 1 ng DNA, the oligonucleotide primers, and annealing conditions and with extension for 1 min at 68ºC. F, forward; R, reverse.