Volume 15, Number 2—February 2009
Dispatch
Enteroviruses in Patients with Acute Encephalitis, Uttar Pradesh, India
Table 1
Serial no. | Region | Location | Primer sequence (5′ → 3′) | Product size, bp |
---|---|---|---|---|
1 | 5’ NCR | 64–84 | CGGTACCTTTGTACGCCTGT | 537 |
2 | 5’ NCR | 601–582 | ATTGTCACCATAAGCAGCCA | 537 |
3 | 5’ NCR | 166–186 | CAAGCACTTCTGTTTCCCCGG | 400 |
4 | 5’ NCR | 566–546 | GAAACACGGACACCCAAAGTA | 400 |
5 | VP1/2A | EV-012 (2917–2936) | ATGTAYGTICCICCIGGIGG | 457 |
6 | VP1/2A | EV-040 (2917–2936) | ATGTAYRTICCIMCIGGIGC | 457 |
7 | VP1/2A | EV-011 (3374–3355) | GCICCIGAYTGITGICCRAA | 457 |
8 | VP1 cDNA | AN32 (3009–3002) | GTYTGCCA | NA |
9 | VP1 cDNA | AN33 (3009–3002) | GAYTGCCA | NA |
10 | VP1 cDNA | AN34 (3111–3104) | CCRTCRTA | NA |
11 | VP1 cDNA | AN35 (3009–3002) | RCTYTGCCA | NA |
12 | VP3 | 224(1977–1996) | GCIATGYTIGGIACICAYRT | 762 |
13 | VP1 | 222 (2969–2951) | CICCIGGIGGIAYRWACAT | 762 |
14 | VP1 | AN89 (2602–2627) | CCAGCACTGACAGCAGYNGARAYNGG | 348–393 |
15 | VP1 | AN88 (2977–2951) | TACTGGACCACCTGGNGGNAYRWACAT | 348–393 |
*NCR, noncoding region of viral genome; VP, virion protein; NA, not applicable.
Page created: December 08, 2010
Page updated: December 08, 2010
Page reviewed: December 08, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.