Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 15, Number 7—July 2009

Dispatch

WU Polyomavirus in Patients Infected with HIV or Hepatitis C Virus, Connecticut, USA, 2007

Michael A. Miller, Carla Weibel, David Ferguson, Marie L. Landry, and Jeffrey S. KahnComments to Author 
Author affiliations: Yale University School of Medicine, New Haven, Connecticut, USA

Main Article

Table 1

Primers used in PCR to detect WU polyomavirus in serum specimens, Connecticut, USA, 2007

Primer Name Sequence (5′ → 3′) Genome coordinates
1 WU2F* GCGCATCAAGAGGCACAGCTACTATTTC 1377–1400
2 WU2R* GCGCCTAGCCTGTGAACTCCATC 1510–1528
3 WUoriFnest† CTCATTTCCCCCTTTGTCAGGATG 5011–5034
4 WUoriRII† CTTTCCGCTGGACTACAAAGGGC 317–339
5 WUoriF† GTAAATTTCCCCAGCAGGTC 5075–5095
6 WUoriR† CGGAAACTTTAAAAGGTCACAG 153–174

*Primers used by Wattier et al. (6).
†The amplicon generated with these primer spans across nt 1 of the 5,229-bp circular virus genome.

Main Article

References
  1. Allander  T, Andreasson  K, Gupta  S, Bjerkner  A, Gordana  B, Perrson  MA, Identification of a third human polyomavirus. J Virol. 2007;81:4130–6. DOIPubMedGoogle Scholar
  2. Gaynor  AM, Nissen  MD, Whiley  DM, MacKay  IM, Lambert  SB, Wu  G, Identification of a novel polyomavirus from patients with acute respiratory tract infections. PLoS Pathog. 2007;3:e64. DOIPubMedGoogle Scholar
  3. Norja  P, Ubillos  I, Templeton  K, Simmonds  P. No evidence for an association between infections with WU and KI polyomaviruses and respiratory disease. J Clin Virol. 2007;40:307–11. DOIPubMedGoogle Scholar
  4. Le  BM, Demertzis  LM, Wu  G, Tibbets  RJ, Buller  R, Arens  MQ, Clinical and epidemiologic characterization of WU polyomavirus infection, St. Louis, Missouri. Emerg Infect Dis. 2007;13:1936–8.PubMedGoogle Scholar
  5. Bialasiewicz  S, Whiley  DM, Lambert  SB, Jacob  K, Bletchly  C, Wang  D, A newly reported human polyomavirus, KI virus, is present in the respiratory tract of Australian children. J Clin Virol. 2007;40:15–8. DOIPubMedGoogle Scholar
  6. Wattier  RL, Vazquez  MV, Weibel  C, Shapiro  ED, Ferguson  D, Landry  ML, Role of human polyomaviruses in respiratory tract disease in young children. Emerg Infect Dis. 2008;14:1766–8. DOIPubMedGoogle Scholar
  7. Khalili  K, Gordon  J, White  MK. The polyomavirus, JCV and its involvement in human disease. Adv Exp Med Biol. 2006;577:274–87. DOIPubMedGoogle Scholar
  8. Hirsch  HH. Polyomavirus BK nephropathy: a (re-)emerging complication in renal transplantation. Am J Transplant. 2002;2:25–30. DOIPubMedGoogle Scholar
  9. Andreoletti  L, Lescieux  A, Lambert  B, Si-Mohamed  A, Matta  M, Wattre  P, Semiquantitative detection of JCV-DNA in peripheral blood leukocytes from HIV-1-infected patients with or without progressive multifocal leukoencephalopathy. J Med Virol. 2002;66:1–7. DOIPubMedGoogle Scholar
  10. Hymes  LC, Warshaw  BL. Polyomavirus (BK) in pediatric renal transplants: evaluation of viremic patients with and without BK associated nephritis. Pediatr Transplant. 2006;10:920–2. DOIPubMedGoogle Scholar
  11. Stolt  A, Sasnauskas  K, Koskela  P, Lehtinen  M, Dillner  J. Seroepidemiology of the human polyomaviruses. J Gen Virol. 2003;84:1499–504. DOIPubMedGoogle Scholar
  12. Costa  C, Bergallo  M, Astegiano  S, Terlizzi  ME, Sidoti  F, Segoloni  GP, Monitoring of BK virus replication in the first year following renal transplantation. Nephrol Dial Transplant. 2008;23:3333–6. DOIPubMedGoogle Scholar
  13. Sharp  CP, Norja  P, Anthony  J, Bell  JE, Simmonds  P. Reactivation and mutation of newly discovered WU, KI, and Merkel cell carcinoma polyomaviruses in immunosuppressed individuals. J Infect Dis. 2009;199:398–404. DOIPubMedGoogle Scholar
  14. zur Hausen  H. Novel human polyomaviruses–re-emergence of a well known virus family as possible human carcinogens. Int J Cancer. 2008;123:247–50. DOIPubMedGoogle Scholar
  15. Feng  H, Shuda  M, Chang  Y, Moore  PS. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science. 2008;319:1096–100. DOIPubMedGoogle Scholar

Main Article

Page created: November 10, 2010
Page updated: November 10, 2010
Page reviewed: November 10, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external