Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 17, Number 10—October 2011

Perspective

Global Spread of Carbapenemase-producing Enterobacteriaceae

Patrice NordmannComments to Author , Thierry Naas, and Laurent Poirel

Author affiliation: Bicêtre Hospital, Le Kremlin-Bicêtre, France

Main Article

Table 3

Oligonucleotides used for screening of main carbapenemase genes in Enterobacteriaceae*

Primer Sequence, 5′ → 3′ Gene Product size, bp
IMP-F GGAATAGAGTGGCTTAAYTC blaIMP 232
IMP-R TCGGTTTAAYAAAACAACCACC
VIM-F GATGGTGTTTGGTCGCATA blaVIM 390
VIM-R CGAATGCGCAGCACCAG
OXA-48-F GCGTGGTTAAGGATGAACAC blaOXA-48 438
OXA-48-R CATCAAGTTCAACCCAACCG
NDM-F GGTTTGGCGATCTGGTTTTC blaNDM 621
NDM-R CGGAATGGCTCATCACGATC
KPC-Fm CGTCTAGTTCTGCTGTCTTG blaKPC 798
KPC-Rm CTTGTCATCCTTGTTAGGCG

*A detailed technique for PCR amplification has been reported by Poirel et al. (34). VIM, Verona integron–encoded metallo-β-lactamase; OXA, oxacillinase; NDM, New Delhi metallo-β-lactamase-1; KPC, Klebsiella pneumoniae carbapenemase.

*A detailed technique for PCR amplification has been reported by Poirel et al. (34). VIM, Verona integron–encoded metallo-β-lactamase; OXA, oxacillinase; NDM, New Delhi metallo-β-lactamase-1; KPC, Klebsiella pneumoniae carbapenemase.

*A detailed technique for PCR amplification has been reported by Poirel et al. (34). VIM, Verona integron–encoded metallo-β-lactamase; OXA, oxacillinase; NDM, New Delhi metallo-β-lactamase-1; KPC, Klebsiella pneumoniae carbapenemase.

Main Article

References
  1. Pitout  JD, Laupland  KB. Extended-spectrum β-lactamase–producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect Dis. 2008;8:159–66. DOIPubMedGoogle Scholar
  2. Queenan  AM, Bush  K. Carbapenemases: the versatile β-lactamases. Clin Microbiol Rev. 2007;20:440–58. DOIPubMedGoogle Scholar
  3. Naas  T, Nordmann  P. Analysis of a carbapenem-hydrolyzing class A β-lactamase from Enterobacter cloacae and of its LysR-type regulatory protein. Proc Natl Acad Sci U S A. 1994;91:7693–7. DOIPubMedGoogle Scholar
  4. Giske  CG, Sundsfjord  AS, Kahlmeter  G, Woodford  N, Nordmann  P, Paterson  DL, Redefining extended-spectrum β-lactamase: balancing science and clinical need. J Antimicrob Chemother. 2009;63:1–4. DOIPubMedGoogle Scholar
  5. Yigit  H, Queenan  AM, Anderson  GJ, Domenech-Sanchez  A, Biddle  JW, Steward  CD, Novel carbapenem-hydrolyzing β-lactamase KPC-1 from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother. 2001;45:1151–61. DOIPubMedGoogle Scholar
  6. Nordmann  P, Cuzon  G, Naas  T. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis. 2009;9:228–36. DOIPubMedGoogle Scholar
  7. Navon-Venezia  S, Leavitt  A, Schwaber  MJ, Rasheed  JK, Srinivasan  A, Patel  JB, First report on a hyperepidemic clone of KPC-3–producing Klebsiella pneumoniae in Israel genetically related to a strain causing outbreaks in the United States. Antimicrob Agents Chemother. 2009;53:818–20. DOIPubMedGoogle Scholar
  8. Cuzon  G, Naas  T, Truong  H, Villegas  MV, Wisell  KT, Carmeli  Y, Worldwide diversity of Klebsiella pneumoniae that produce β-lactamase blaKPC-2 gene. Emerg Infect Dis. 2010;16:1349–56. DOIPubMedGoogle Scholar
  9. Borer  A, Saidel-Odes  L, Riesenberg  K, Eskira  S, Peled  N, Nativ  R, Attributable mortality rate for carbapenem-resistant Klebsiella pneumoniae bacteremia. Infect Control Hosp Epidemiol. 2009;30:972–6. DOIPubMedGoogle Scholar
  10. Patel  G, Huprikar  S, Factor  SH, Jenkins  SG, Calfee  DP. Outcomes of carbapenem-resistant Klebsiella pneumoniae infection and the impact of antimicrobial and adjunctive therapies. Infect Control Hosp Epidemiol. 2008;29:1099–106. DOIPubMedGoogle Scholar
  11. Schwaber  MJ, Klarfeld-Lidji  S, Navon-Venezia  S, Schwartz  D, Leavitt  A, Carmeli  Y. Predictors of carbapenem-resistant Klebsiella pneumoniae acquisition among hospitalized adults and effect of acquisition on mortality. Antimicrob Agents Chemother. 2008;52:1028–33. DOIPubMedGoogle Scholar
  12. Walsh  TR, Toleman  MA, Poirel  L, Nordmannn  P. Metallo-β-lactamases: the quiet before the storm? Clin Microbiol Rev. 2005;18:306–25. DOIPubMedGoogle Scholar
  13. Ito  H, Arakawa  Y, Ohsuka  S, Wacharotayankun  R, Kato  N, Ohta  M. Plasmid-mediated dissemination of the metallo-β-lactamase gene blaIMP among clinically isolated strains of Serratia marcescens. Antimicrob Agents Chemother. 1995;39:824–9.PubMedGoogle Scholar
  14. Daikos  GL, Petrikkos  P, Psichogiou  M, Kosmidis  C, Vryonis  E, Skoutelis  A, Prospective observational study of the impact of VIM-1 metallo-β-lactamase on the outcome of patients with Klebsiella pneumoniae bloodstream infections. Antimicrob Agents Chemother. 2009;53:1868–73. DOIPubMedGoogle Scholar
  15. Yong  D, Toleman  MA, Giske  CG, Cho  HS, Sundman  K, Lee  K, Characterization of a new metallo-β-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53:5046–54. DOIPubMedGoogle Scholar
  16. Kumarasamy  KK, Toleman  MA, Walsh  TR, Bagaria  J, Butt  F, Balakrishnan  R, Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10:597–602. DOIPubMedGoogle Scholar
  17. Nordmann  P, Poirel  L, Toleman  MA, Walsh  TR. Does broad-spectrum β-lactam resistance due to NDM-1 herald the end of the antibiotic era for treatment of infections caused by Gram-negative bacteria? J Antimicrob Chemother. 2011;66:689–92. DOIPubMedGoogle Scholar
  18. Walsh  TR, Weeks  J, Livermore  DM, Toleman  MA. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis. 2011;11:355–62. DOIPubMedGoogle Scholar
  19. Poirel  L, Hombrouk-Alet  C, Freneaux  C, Bernabeu  S, Nordmann  P. Global spread of New Delhi metallo-β-lactamase 1. Lancet Infect Dis. 2010;10:832. DOIPubMedGoogle Scholar
  20. Coque  TM, Novais  A, Carattoli  A, Poirel  L, Pitout  J, Peixe  L, Dissemination of clonally related Escherichia coli strains expressing extended-spectrum β-lactamase CTX-M-15. Emerg Infect Dis. 2008;14:195–200. DOIPubMedGoogle Scholar
  21. Poirel  L, Héritier  C, Tolün  V, Nordmann  P. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother. 2004;48:15–22. DOIPubMedGoogle Scholar
  22. Carrër  A, Poirel  L, Yilmaz  M, Akan  OA, Feriha  C, Cuzon  G, Spread of OXA-48–encoding plasmid in Turkey and beyond. Antimicrob Agents Chemother. 2010;54:1369–73. DOIPubMedGoogle Scholar
  23. Cuzon  G, Ouanich  J, Gondret  R, Naas  T, Nordmann  P. Outbreak of OXA-48–positive carbapenem-resistant Klebsiella pneumoniae isolates in France. Antimicrob Agents Chemother. 2011;55:2420–3. DOIPubMedGoogle Scholar
  24. Moquet  O, Bouchiat  C, Kinana  A, Seck  A, Arouna  O, Bercion  R, Class D OXA-48 carbapenemase in multidrug-resistant enterobacteria, Senegal. Emerg Infect Dis. 2011;17:143–4. DOIPubMedGoogle Scholar
  25. Benouda  A, Touzani  O, Khairallah  MT, Araj  GF, Matar  GM. First detection of oxacillinase-mediated resistance to carbapenems in Klebsiella pneumoniae from Morocco. Ann Trop Med Parasitol. 2010;104:327–30. DOIPubMedGoogle Scholar
  26. Poirel  L, Ros  A, Carrër  A, Fortineau  N, Carricajo  A, Berthelot  P, Cross-border transmission of OXA-48–producing Enterobacter cloacae from Morocco to France. J Antimicrob Chemother. 2011;66:1181–2. DOIPubMedGoogle Scholar
  27. Castanheira  M, Deshpande  LM, Mathai  D, Bell  JM, Jones  RN, Mendes  RE. Early dissemination of NDM-1– and OXA-181–producing Enterobacteriaceae in Indian hospitals: report from the SENTRY Antimicrobial Surveillance Program, 2006–2007. Antimicrob Agents Chemother. 2011;55:1274–8. DOIPubMedGoogle Scholar
  28. Kalpoe  JS, Al Naiemi  N, Poirel  L, Nordmann  P. Detection of an Ambler class D OXA-48–type β-lactamase in a Klebsiella pneumoniae strain in The Netherlands. J Med Microbiol. 2011;60:677–8. DOIPubMedGoogle Scholar
  29. Miriagou  V, Cornaglia  G, Edelstein  M, Galani  I, Giske  CG, Gniadkowski  M, Acquired carbapenemases in Gram-negative bacterial pathogens: detection and surveillance issues. Clin Microbiol Infect. 2010;16:112–22. DOIPubMedGoogle Scholar
  30. Thomson  KS. Extended-spectrum β-lactamase, AmpC and carbapenemase issues. J Clin Microbiol. 2010;48:1019–25. DOIPubMedGoogle Scholar
  31. Centers for Disease Control and Prevention. Guidance for control of infections with carbapenem-resistant or carbapenemase-producing Enterobacteriaceae in acute care facilities. MMWR Morb Mortal Wkly Rep. 2009;58:256–60.PubMedGoogle Scholar
  32. Galani  I, Rekatsina  PD, Hatzaki  D, Plachouras  D, Souli  M, Giamarellou  H. Evaluation of different laboratory tests for the detection of metallo-β-lactamase production in Enterobacteriaceae. J Antimicrob Chemother. 2008;61:548–53. DOIPubMedGoogle Scholar
  33. Nordmann  P, Poirel  L, Carrër  A, Toleman  MA, Walsh  TR. How to detect NDM-1 producers. J Clin Microbiol. 2011;49:718–21. DOIPubMedGoogle Scholar
  34. Poirel  L, Walsh  TR, Cuvillier  V, Nordmann  P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70:119–23. DOIPubMedGoogle Scholar
  35. Naas  T, Cuzon  G, Bogaerts  P, Glupczynski  Y, Nordmann  P. Evaluation of a DNA microarray (Check-MDR CT102) for rapid detection of TEM, SHV, and CTX-M extended-spectrum β-lactamases and of KPC, OXA-48, VIM, IMP, and NDM-1 carbapenemases. J Clin Microbiol. 2011;49:1608–13. DOIPubMedGoogle Scholar
  36. Adler  A, Navon-Venezia  S, Moran-Gilad  J, Marcos  E, Schwartz  D, Carmeli  Y. Laboratory and clinical evaluation of screening agar plates for the detection of carbapenem-resistant enterobacteriaceae from surveillance rectal swabs. J Clin Microbiol. 2011;49:2239–42. DOIPubMedGoogle Scholar
  37. Carrër  A, Fortineau  N, Nordmann  P. Use of ChromID ESBL medium for detecting carbapenemase-producing Enterobacteriaceae. J Clin Microbiol. 2010;48:1913–4. DOIPubMedGoogle Scholar
  38. Jean  SS, Hsueh  PR. High burden of antibimicrobial resistance in Asia. Int J Antimicrob Agents. 2011;37:291–5. DOIPubMedGoogle Scholar
  39. Falagas  ME, Karageorgopoulos  DE, Nordmann  P. Therapeutic options with Enterobacteriaceae producing carbapenem-hydrolyzing enzymes. Future Microbiol. 2011;6:653–6. DOIPubMedGoogle Scholar

Main Article

Page created: September 19, 2011
Page updated: September 19, 2011
Page reviewed: September 19, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external