Volume 18, Number 1—January 2012
Research
Invasive Meningococcal Capsular Group Y Disease, England and Wales, 2007–2009
Table 1
Primers used for genotypic analysis of lpxL1 of meningococcal capsular group Y, England and Wales, 2007–2009*
PCR/sequence | Primer identification no. | Direction | Sequence, 5′ → 3′ | Reference |
---|---|---|---|---|
PCR/sequence | lpxL1-F†‡§ | Forward | TGCAGGTCAAACAGGCGGTAGT | (14) |
PCR/sequence | lpxL1-R†¶# | Reverse | TTCAT(A/G)GGTTTGCGGTATTTCTTCCA | (14) |
PCR | lpxL1-rR4‡ | Reverse | TCCACTTGAAATCGCGGCTGTC | NA |
Sequence | lpxL1-s1C# | Forward | GTTCGAGATGGCGGTGTAC | NA |
Sequence | lpxL1-s2# | Reverse | GAATCGTTGCGTCCGAAATCCTG | NA |
Sequence | lpxL1-rR3§ | Reverse | AATACAGGCTTTCGCCTGCG | NA |
Sequence | lpxL1-Rnew§ | Reverse | GTCAGTAAAAATCGGGGCTGCC | NA |
*NA, not applicable.
†Default PCR primer.
‡Alternative PCR primer.
§Used for sequence analysis of alternative PCR products (14).
¶Degenerate base added for this study.
#Used for sequence analysis of default PCR products.
References
- Tan LK, Carlone GM, Borrow R. Advances in the development of vaccines against Neisseria meningitidis. N Engl J Med. 2010;362:1511–20. DOIPubMedGoogle Scholar
- Harrison LH, Trotter CL, Ramsay ME. Global epidemiology of meningococcal disease. Vaccine. 2009;27(Suppl 2):B51–63. DOIPubMedGoogle Scholar
- Campbell H, Andrews N, Borrow R, Trotter C, Miller E. Updated postlicensure surveillance of the meningococcal C conjugate vaccine in England and Wales: effectiveness, validation of serological correlates of protection, and modeling predictions of the duration of herd immunity. Clin Vaccine Immunol. 2010;17:840–7. DOIPubMedGoogle Scholar
- Campbell H, Borrow R, Salisbury D, Miller E. Meningococcal C conjugate vaccine: the experience in England and Wales. Vaccine. 2009;27(Suppl 2):B20–9. DOIPubMedGoogle Scholar
- Meningococcal Reference Unit, Gray SJ, Trotter CL, Ramsay ME, Guiver M, Fox AJ, et al. Epidemiology of meningococcal disease in England and Wales 1993/94 to 2003/04: contribution and experiences of the Meningococcal Reference Unit. J Med Microbiol. 2006;55:887–96. DOIPubMedGoogle Scholar
- Borrow R. Meningococcal disease and prevention at the Hajj. Travel Med Infect Dis. 2009;7:219–25. DOIPubMedGoogle Scholar
- Hahné SJ, Gray SJ, Aguilera J-F, Crowcroft NS, Nichols T, Kaczmarski EB, W135 meningococcal disease in England and Wales associated with Hajj 2000 and 2001. Lancet. 2002;359:582–3. DOIPubMedGoogle Scholar
- Bidmos FA, Neal KR, Oldfield NJ, Turner DP. Ala'Aldeen DA, Bayliss CD. Persistence, replacement, and rapid clonal expansion of meningococcal carriage isolates in a 2008 university student cohort. J Clin Microbiol. 2011;49:506–12. DOIPubMedGoogle Scholar
- Maiden MC, Ibarz-Pavón AB, Urwin R, Gray SJ, Andrews NJ, Clarke SC, Impact of meningococcal serogroup C conjugate vaccines on carriage and herd immunity. J Infect Dis. 2008;197:737–43. DOIPubMedGoogle Scholar
- Lucidarme J, Comanducci M, Findlow J, Gray SJ, Kaczmarski EB, Guiver M, Characterization of fHbp, nhba (gna2132), nadA, porA, sequence type (ST), and genomic presence of IS1301 in group B meningococcal ST269 clonal complex isolates from England and Wales. J Clin Microbiol. 2009;47:3577–85. DOIPubMedGoogle Scholar
- Lucidarme J, Comanducci M, Findlow J, Gray SJ, Kaczmarski EB, Guiver M, Characterization of fHbp, nhba (gna2132), nadA, porA, and sequence type in group B meningococcal case isolates collected in England and Wales during January 2008 and potential coverage of an investigational group B meningococcal vaccine. Clin Vaccine Immunol. 2010;17:919–29. DOIPubMedGoogle Scholar
- Lucidarme J, Tan L, Exley RM, Findlow J, Borrow R, Tang CM. Characterisation of Neisseria meningitidis isolates that do not express the virulence factor and vaccine antigen, factor H binding protein. Clin Vaccine Immunol. 2011;18:1002–14. DOIPubMedGoogle Scholar
- Jolley KA, Brehony C, Maiden MC. Molecular typing of meningococci: recommendations for target choice and nomenclature. FEMS Microbiol Rev. 2007;31:89–96. DOIPubMedGoogle Scholar
- Tzeng YL, Ambrose KD, Zughaier S, Zhou X, Miller YK, Shafer WM, Cationic antimicrobial peptide resistance in Neisseria meningitidis. J Bacteriol. 2005;187:5387–96. DOIPubMedGoogle Scholar
- Health Protection Agency. Meningococcal Reference Unit isolates of Neisseria meningitidis: England and Wales, by serogroup and epidemiological year, 1998/99–2008/09. 2011 [cited 2011 Nov 21]. http://www.hpa.org.uk/web/HPAweb&HPAwebStandard/HPAweb_C/1234859711901
- Fransen F, Heckenberg SG, Hamstra HJ, Feller M, Boog CJ, van Putten JP, Naturally occurring lipid A mutants in Neisseria meningitidis from patients with invasive meningococcal disease are associated with reduced coagulopathy. PLoS Pathog. 2009;5:e1000396. DOIPubMedGoogle Scholar
- Centers for Disease Control and Prevention. Active Bacterial Core Surveillance (ABCs) report. Emerging Infections Program Network. Neisseria meningitidis, 2009. Oct2010 File—17 Nov 2010. 2010 [cited 2011 Nov 21]. http://www.cdc.gov/abcs/reports-findings/survreports/mening09.pdf
- Winstead JM, McKinsey DS, Tasker S, De Groote MA, Baddour LM. Meningococcal pneumonia: characterization and review of cases seen over the past 25 years. Clin Infect Dis. 2000;30:87–94. DOIPubMedGoogle Scholar
- Koppes GM, Ellenbogen C, Gebhart RJ. Group Y meningococcal disease in United States Air Force recruits. Am J Med. 1977;62:661–6. DOIPubMedGoogle Scholar
- Wang JL, Liu DP, Yen JJ, Yu CJ, Liu HC, Lin CY, Clinical features and outcome of sporadic serogroup W135 disease Taiwan. BMC Infect Dis. 2006;6:7. DOIPubMedGoogle Scholar
- Faye A, Mariani-Kurkdjian P, Taha MK, Angoulvant F, Antonios M, Aubertin G, Clinical features and outcome of pediatric Neisseria meningitidis serogroup W135 infection: a report of 5 cases. Clin Infect Dis. 2004;38:1635–7. DOIPubMedGoogle Scholar
- Vienne P, Ducos-Galand M, Guiyoule A, Pires R, Giorgini D, Taha MK, The role of particular strains of Neisseria meningitidis in meningococcal arthritis, pericarditis, and pneumonia. Clin Infect Dis. 2003;37:1639–42. DOIPubMedGoogle Scholar
- Centers for Disease Control and Prevention. Serogroup Y meningococcal disease—Illinois, Connecticut, and selected areas, United States, 1989–1996. MMWR Morb Mortal Wkly Rep. 1996;45:1010–3.PubMedGoogle Scholar
- Racoosin JA, Whitney CG, Conover CS, Diaz PS. Serogroup Y meningococcal disease in Chicago, 1991–1997. JAMA. 1998;280:2094–8. DOIPubMedGoogle Scholar
- Le Saux N, Bettinger JA, Wootton S, Halperin SA, Vaudry W, Scheifele DW, Profile of serogroup Y meningococcal infections in Canada: implications for vaccine selection. Can J Infect Dis Med Microbiol. 2009;20:e130–4.PubMedGoogle Scholar
- Erickson L, De WP. Complications and sequelae of meningococcal disease in Quebec, Canada, 1990–1994. Clin Infect Dis. 1998;26:1159–64. DOIPubMedGoogle Scholar
- Jensen ES, Schonheyder HC, Lind I, Berthelsen L, Norgard B, Sorensen HT. Neisseria meningitidis phenotypic markers and septicaemia, disease progress and case-fatality rate of meningococcal disease: a 20-year population-based historical follow-up study in a Danish county. J Med Microbiol. 2003;52:173–9. DOIPubMedGoogle Scholar
- Rosenstein NE, Perkins BA, Stephens DS, Lefkowitz L, Cartter ML, Danila R, The changing epidemiology of meningococcal disease in the United States, 1992–1996. J Infect Dis. 1999;180:1894–901. DOIPubMedGoogle Scholar
- Pålsson-McDermott EM, O’Neill LA. Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology. 2004;113:153–62. DOIPubMedGoogle Scholar
- Fransen F, Hamstra HJ, Boog CJ, van Putten JP, van den Dobbelsteen GP, van der Ley P. The structure of Neisseria meningitidis lipid A determines outcome in experimental meningococcal disease. Infect Immun. 2010;78:3177–86. DOIPubMedGoogle Scholar
- van der Ley P, Rodenburg G, Fransen F, Bogaert D, Schipper K, Claus H, Naturally occurring lipid A variants among meningococcal carriage and disease isolates. In: Abstracts of the Seventeenth International Pathogenic Neisseria Conference (IPNC); Banff, Canada; 2010 Sep 11–16; Abstract OM12 [cited 2011 Nov 21]. http://neisseria.org/ipnc/history.shtml
- Comanducci M, Bambini S, Brunelli B, Adu-Bobie J, Aricò B, Capecchi B, NadA, a novel vaccine candidate of Neisseria meningitidis. J Exp Med. 2002;195:1445–54. DOIPubMedGoogle Scholar
- Comanducci M, Bambini S, Caugant DA, Mora M, Brunelli B, Capecchi B, NadA diversity and carriage in Neisseria meningitidis. Infect Immun. 2004l;72:4217–23. DOIPubMedGoogle Scholar
- Nägele V, Heesemann J, Schielke S, Jimenez-Soto LF, Kurzai O, Ackermann N. Neisseria meningitidis adhesin NadA targets β1 integrins: functional similarity to Yersinia invasin. J Biol Chem. 2011;286:20536–46. DOIPubMedGoogle Scholar