Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 20, Number 10—October 2014

Research

Person-to-Person Household and Nosocomial Transmission of Andes Hantavirus, Southern Chile, 2011

Constanza Martinez-Valdebenito, Mario Calvo, Cecilia Vial, Rita Mansilla, Claudia Marco, R. Eduardo Palma, Pablo Vial, Francisca Valdivieso, Gregory Mertz, and Marcela FerrésComments to Author 
Author affiliations: Pontificia Universidad Católica de Chile, Santiago, Chile (C. Martinez-Valdebenito, R.E. Palma, M. Ferrés); Universidad Austral de Chile, Valdivia, Chile (M. Calvo); Clínica Alemana–Universidad del Desarrollo, Santiago, Chile (C. Vial, C. Marco, P.A. Vial, F. Valdivieso); Secretaría Regional Ministerial, Valdivia, Chile (R. Mansilla); University of New Mexico, Albuquerque, New Mexico, USA (G. Mertz)

Main Article

Table 1

Primers used for M segment amplification and sequencing of Andes hantavirus

Primer identification Primer sequences, 5′ → 3′
GN1+ TAGTAGTAGACTCCGCAAGAAGAAG
GN534− TCCTGCTKKTAAACACACTAGCCAT
GC94+ TGCAAATGATTGTGTTAGTAACACCA
GC674− GTATTAGAGCCCCTAGCACAGGTT

Main Article

Page created: September 12, 2014
Page updated: September 12, 2014
Page reviewed: September 12, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external