Volume 21, Number 10—October 2015
    
    Dispatch
Detection of Mixed Infections with Plasmodium spp. by PCR, India, 2014
Table 2
Characteristics of PCR primers specific for 18S rRNA gene of Plasmodium spp., India*
| Genus or species | 
Primer | 
Sequence, 5′→3′ | 
PCR product, bp | 
PCR Program | No. cycles | 
|||||
|---|---|---|---|---|---|---|---|---|---|---|
| Denaturation | 
Annealing | 
Elongation | 
||||||||
| Temp, °C | 
Time, min | 
Temp, °C | 
Time, min | 
Temp ,°C | 
Time, min | 
|||||
| Plasmodium | F | TTAAAATTGTTGCAGTTAAAACG | 1,200 | 94 | 1 | 58 | 2 | 72 | 2 | 25 | 
| R | CCTGTTGTTGCCTTAAACTTC | 1,200 | 94 | 1 | 58 | 2 | 72 | 2 | 25 | |
| P. falciparum | F | TTAAACTGGTTTGGGAAAACCAAATATATT | 205 | 94 | 1 | 58 | 2 | 72 | 2 | 30 | 
| R | ACACAATGAACTCAATCATGACTACCCGTC | 205 | 94 | 1 | 58 | 2 | 72 | 2 | 30 | |
| P. vivax | F | CGCTTCTAGCTTAATCCACATAACTGATAC | 120 | 94 | 1 | 58 | 2 | 72 | 2 | 30 | 
| R | ACTTCCAAGCCGAAGCAAAGAAAG TCCTTA | 120 | 94 | 1 | 58 | 2 | 72 | 2 | 30 | |
| P. malariae | F | ATAACATAGTTGTACGTTAAGAATAACCGC | 144 | 94 | 1 | 58 | 2 | 72 | 2 | 30 | 
| R | AAAATTCCCATGCATAAAAAATTATACAAA | 144 | 94 | 1 | 58 | 2 | 72 | 2 | 30 | |
| P. ovale | F | ATCTCTTTTGCTATTTTTTAGTATTGGAGA | 800 | 94 | 1 | 58 | 2 | 72 | 2 | 30 | 
| R | GGAAAAGGACACATTAATTGTATCCTAGTG | 800 | 94 | 1 | 58 | 2 | 72 | 2 | 30 | |
| P. knowlesi | F | CAGAGATCCGTTCTCATGATTTCCATGG | 209 | 95 | 0.5 | 57 | 0.5 | 72 | 0.75 | 35 | 
| R | CTRAACACCTCATGTCGTGGTAG | 209 | 95 | 0.5 | 57 | 0.5 | 72 | 0.75 | 35 | |
| P. ovale | F | CTACTTGACATTTCTACTTACA | 938 | 95 | 1 | 50 | 1 | 72 | 1 | 35 | 
| R | CGTTCTTGATTAATGGAAGTAT | 938 | 95 | 1 | 50 | 1 | 72 | 1 | 35 | |
| P. ovale (curtisi and wallikeri) | F | GCTGTAGCTAATACTTGCTTTA | 827 | 95 | 1 | 55 | 1 | 72 | 1 | 25 | 
| R | TTCACCTCTGACATCTGAATC | 827 | 95 | 1 | 55 | 1 | 72 | 1 | 25 | |
*F, forward; R, reverse.
Page created: September 22, 2015
                            Page updated: September 22, 2015
                            Page reviewed: September 22, 2015
        
    The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.