Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 26, Number 12—December 2020

Dispatch

Differential Tropism of SARS-CoV and SARS-CoV-2 in Bat Cells

Susanna K.P. Lau1Comments to Author , Antonio C.P. Wong1, Hayes K.H. Luk1, Kenneth S.M. Li, Joshua Fung, Zirong He, Flora K.K. Cheng, Tony T.Y. Chan, Stella Chu, Kam Leng Aw-Yong, Terrence C.K. Lau, Kitty S.C. Fung, and Patrick C.Y. WooComments to Author 
Author affiliations: The University of Hong Kong, Hong Kong, China (S.K.P. Lau, A.C.P. Wong, H.K.K. Luk, K.S.M. Li, J. Fung, Z. He, F.K.K. Cheng, T.T.Y. Chan, S. Chu, K.L. Aw-Yong, P.C.Y. Woo); City University of Hong Kong, Hong Kong (T.C.K. Lau); United Christian Hospital, Kwun Tong, Hong Kong (K.S.C. Fung)

Main Article

Table 1

Primers used for reverse transcription quantitative PCR in study of coronavirus in bats*

Target Primers, 5¢ ® 3¢
Forward Reverse Probe
SARS-CoV N gene
CDC_N3
GGGAGCCTTGAATACACCAAAA
TGTAGCACGATTGCAGCATTG
(FAM)
AYCACATTGGCACCCGCAATCCTG (BHQ1)
β-actin CTCTTCCAGCCCTCCTTCCT (for bat cells) or
CTCTTCCAGCCTTCCTTCCT (for human cells) TTCATCGTGCTGGGAGCC (for bat cells) or 
TTCATTGTGCTGGGTGCC (for human cells) (FAM)
CATGAAGTGYGACGTBGACATCCG(BHQ1)

*CoV, coronavirus; N, nucleocapsid protein; SARS, severe acute respiratory syndrome.

Main Article

1These authors contributed equally to this article.

Page created: July 17, 2020
Page updated: November 19, 2020
Page reviewed: November 19, 2020
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external