Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 28, Number 3—March 2022

Research

Novel Hendra Virus Variant Detected by Sentinel Surveillance of Horses in Australia

Edward J. Annand1Comments to Author , Bethany A. Horsburgh1, Kai Xu, Peter A. Reid, Ben Poole, Maximillian C. de Kantzow, Nicole Brown, Alison Tweedie, Michelle Michie, John D. Grewar, Anne E. Jackson, Nagendrakumar B. Singanallur, Karren M. Plain, Karan Kim, Mary Tachedjian, Brenda van der Heide, Sandra Crameri, David T. Williams, Cristy Secombe, Eric D. Laing, Spencer Sterling, Lianying Yan, Louise Jackson, Cheryl Jones, Raina K. Plowright, Alison J. Peel, Andrew C. Breed, Ibrahim Diallo, Navneet K. Dhand, Philip N. Britton, Christopher C. Broder, Ina Smith2, and John-Sebastian Eden2
Author affiliations: EquiEpiVet, Equine Veterinary and One Health Epidemiology, Aireys Inlet, Victoria, Australia (E.J. Annand); Department of Agriculture, Water, and the Environment Epidemiology and One Health Section, Canberra (E.J. Annand, M.C. de Kantzow, A.C. Breed); University of Sydney School of Veterinary Science and Institute for Infectious Diseases, Sydney, New South Wales, Australia (E.J. Annand, N. Brown, A. Tweedie, A.E. Jackson, K.M. Plain, N.K. Dhand); CSIRO Health and Biosecurity Black Mountain Laboratories, Canberra, Australian Capital Territory, Australia (E.J. Annand, M. Michie, I. Smith); Westmead Institute for Medical Research, Sydney (B.A. Horsburgh, K. Kim, J.-S. Eden); University of Sydney School of Medicine, Sydney (B.A. Horsburgh, C. Jones, P.N. Britton, J.-S. Eden); Ohio State University College of Veterinary Medicine, Columbus, Ohio, USA (K. Xu); Private equine veterinary practice, Brisbane, Queensland, Australia (P.A. Reid); Cooroora Veterinary Clinic, Cooroy, Queensland, Australia (B. Poole); JData, Cape Town, South Africa (J.D. Grewar); University of Pretoria, Pretoria, South Africa (J.D. Grewar); CSIRO Australian Centre for Disease Preparedness, Geelong, Victoria, Australia (N.B. Singanallur, M. Tachedjian, B. van der Heide, S. Crameri, D.T. Williams); Murdoch University School of Veterinary Medicine and The Animal Hospital, Murdoch, Western Australia, Australia (C. Secombe); Uniformed Services University of the Health Sciences Microbiology and Immunology, Bethesda, Maryland, USA (E.D. Laing, S. Sterling, L. Yan, C.C. Broder); Queensland Department of Agriculture and Fisheries Biosecurity Sciences Laboratory, Brisbane (L. Jackson, I. Diallo); Children’s Hospital at Westmead, Infectious Diseases, Sydney (C. Jones, P.N. Britton); Montana State University, Bozeman, Montana, USA (R.K. Plowright); Griffith University Centre for Planetary Health and Food Security, Brisbane (A.J. Peel); University of Queensland School of Veterinary Science, Gatton, Queensland, Australia (A.C. Breed)

Main Article

Table 1

Oligonucleotides used for duplex quantitative reverse transcription PCR targeting the matrix gene of novel Hendra virus variant from horse in Australia

Virus Name Sequence, 5′ → 3′* Reference
Prototype
Mr_fwd_1 CTTCGACAAAGACGGAACCAA (34)
Mr_rev_1 CCAGCTCGTCGGACAAAATT
Mr_prb_1
FAM-TGGCATCTT-ZEN-TCATGCTCCATCTCGG-IABk
Variant Mv_fwd_1 TCTCGACAAGGACGGAGCTAA Referent
Mv_rev_1 CCGGCTCGTCGAACAAAATT
Mv_prb_1 HEX-TGGCATCCT-ZEN-TCATGCTTCACCTTGG-IABk

*FAM and HEX 5′ reporter dyes were combined with ZEN Internal Quencher and the 3′ quencher Iowa Black, and supplied by Integrated DNA Technologies (https://www.idtdna.com).

Main Article

References
  1. Eaton  BT, Broder  CC, Middleton  D, Wang  L-F. Hendra and Nipah viruses: different and dangerous. Nat Rev Microbiol. 2006;4:23–35. DOIPubMedGoogle Scholar
  2. Selvey  LA, Wells  RM, McCormack  JG, Ansford  AJ, Murray  K, Rogers  RJ, et al. Infection of humans and horses by a newly described morbillivirus. Med J Aust. 1995;162:642–5. DOIPubMedGoogle Scholar
  3. Wong  KT, Tan  CT. Clinical and pathological manifestations of human henipavirus infection. Curr Top Microbiol Immunol. 2012;359:95–104. DOIPubMedGoogle Scholar
  4. Playford  EG, McCall  B, Smith  G, Slinko  V, Allen  G, Smith  I, et al. Human Hendra virus encephalitis associated with equine outbreak, Australia, 2008. Emerg Infect Dis. 2010;16:219–23. DOIPubMedGoogle Scholar
  5. Murray  K, Rogers  R, Selvey  L, Selleck  P, Hyatt  A, Gould  A, et al. A novel morbillivirus pneumonia of horses and its transmission to humans. Emerg Infect Dis. 1995;1:31–3. DOIPubMedGoogle Scholar
  6. New South Wales Health. Summary of human cases of Hendra virus infection [cited 2021 Apr 23]. https://www.health.nsw.gov.au/Infectious/controlguideline/Pages/hendra-case-summary.aspx
  7. Arunkumar  G, Chandni  R, Mourya  DT, Singh  SK, Sadanandan  R, Sudan  P, et al.; Nipah Investigators People and Health Study Group. Outbreak investigation of Nipah virus disease in Kerala, India, 2018. J Infect Dis. 2019;219:1867–78. DOIPubMedGoogle Scholar
  8. Ching  PK, de los Reyes  VC, Sucaldito  MN, Tayag  E, Columna-Vingno  AB, Malbas  FF Jr, et al. Outbreak of henipavirus infection, Philippines, 2014. Emerg Infect Dis. 2015;21:328–31. DOIPubMedGoogle Scholar
  9. Nikolay  B, Salje  H, Hossain  MJ, Khan  AKMD, Sazzad  HMS, Rahman  M, et al. Transmission of Nipah virus—14 years of investigations in Bangladesh. N Engl J Med. 2019;380:1804–14. DOIPubMedGoogle Scholar
  10. Amaya  M, Broder  CC. Vaccines to emerging viruses: Nipah and Hendra. Annu Rev Virol. 2020;7:447–73. DOIPubMedGoogle Scholar
  11. Middleton  D, Pallister  J, Klein  R, Feng  YR, Haining  J, Arkinstall  R, et al. Hendra virus vaccine, a one health approach to protecting horse, human, and environmental health. Emerg Infect Dis. 2014;20:372–9. DOIPubMedGoogle Scholar
  12. Playford  EG, Munro  T, Mahler  SM, Elliott  S, Gerometta  M, Hoger  KL, et al. Safety, tolerability, pharmacokinetics, and immunogenicity of a human monoclonal antibody targeting the G glycoprotein of henipaviruses in healthy adults: a first-in-human, randomised, controlled, phase 1 study. Lancet Infect Dis. 2020;20:445–54. DOIPubMedGoogle Scholar
  13. Dong  J, Cross  RW, Doyle  MP, Kose  N, Mousa  JJ, Annand  EJ, et al. Potent henipavirus neutralization by antibodies recognizing diverse sites on Hendra and Nipah virus receptor binding protein. Cell. 2020;183:1536–1550.e17. DOIPubMedGoogle Scholar
  14. Doyle  MP, Kose  N, Borisevich  V, Binshtein  E, Amaya  M, Nagel  M, et al. Cooperativity mediated by rationally selected combinations of human monoclonal antibodies targeting the henipavirus receptor binding protein. Cell Rep. 2021;36:109628. DOIPubMedGoogle Scholar
  15. Dang  HV, Cross  RW, Borisevich  V, Bornholdt  ZA, West  BR, Chan  Y-P, et al. Broadly neutralizing antibody cocktails targeting Nipah virus and Hendra virus fusion glycoproteins. Nat Struct Mol Biol. 2021;28:426–34. DOIPubMedGoogle Scholar
  16. Geisbert  TW, Bobb  K, Borisevich  V, Geisbert  JB, Agans  KN, Cross  RW, et al. A single dose investigational subunit vaccine for human use against Nipah virus and Hendra virus. NPJ Vaccines. 2021;6:23. DOIPubMedGoogle Scholar
  17. Kirkland  PD, Gabor  M, Poe  I, Neale  K, Chaffey  K, Finlaison  DS, et al. Hendra virus infection in dog, Australia, 2013. Emerg Infect Dis. 2015;21:2182–5. DOIPubMedGoogle Scholar
  18. Edson  D, Field  H, McMichael  L, Vidgen  M, Goldspink  L, Broos  A, et al. Routes of Hendra virus excretion in naturally-infected flying-foxes: implications for viral transmission and spillover risk. PLoS One. 2015;10:e0140670. DOIPubMedGoogle Scholar
  19. Burroughs  AL, Durr  PA, Boyd  V, Graham  K, White  JR, Todd  S, et al. Hendra virus infection dynamics in the grey-headed flying fox (Pteropus poliocephalus) at the southern-most extent of its range: further evidence this species does not readily transmit the virus to horses. PLoS One. 2016;11:e0155252. DOIPubMedGoogle Scholar
  20. Edson  D, Peel  AJ, Huth  L, Mayer  DG, Vidgen  ME, McMichael  L, et al. Time of year, age class and body condition predict Hendra virus infection in Australian black flying foxes (Pteropus alecto). Epidemiol Infect. 2019;147:e240. DOIPubMedGoogle Scholar
  21. Boardman  WSJ, Baker  ML, Boyd  V, Crameri  G, Peck  GR, Reardon  T, et al. Seroprevalence of three paramyxoviruses; Hendra virus, Tioman virus, Cedar virus and a rhabdovirus, Australian bat lyssavirus, in a range expanding fruit bat, the Grey-headed flying fox (Pteropus poliocephalus). PLoS One. 2020;15:e0232339. DOIPubMedGoogle Scholar
  22. Plowright  RK, Eby  P, Hudson  PJ, Smith  IL, Westcott  D, Bryden  WL, et al. Ecological dynamics of emerging bat virus spillover. Proc Biol Sci. 2015;282:20142124. DOIPubMedGoogle Scholar
  23. Annand  EJ, Reid  PA, Johnson  J, Gilbert  GL, Taylor  M, Walsh  M, et al. Citizens’ juries give verdict on whether private practice veterinarians should attend unvaccinated Hendra virus suspect horses. Aust Vet J. 2020;98:273–9. DOIPubMedGoogle Scholar
  24. Animal Health Australia. Animal health surveillance quarterly [cited 2021 May 21]. file:///C:/Users/tkp3/Downloads/Animal%20Health%20Surveillance%20Quarterly%20Vol%2026%20Iss%201%20%20(2).pdf
  25. Government of South Australia. Department of Primary Industries and Regions. Hendra virus in South Australia. 2018 [cited 2021 May 21]. https://pir.sa.gov.au/biosecurity/animal_health/horses/hendra_virus#toc1
  26. Agnihotri  K, Pease  B, Oakey  J, Campbell  G. Confirmation of Elsey virus infection in a Queensland horse with mild neurologic signs. J Vet Diagn Invest. 2016;28:445–8. DOIPubMedGoogle Scholar
  27. Smith  IL, Halpin  K, Warrilow  D, Smith  GA. Development of a fluorogenic RT-PCR assay (TaqMan) for the detection of Hendra virus. J Virol Methods. 2001;98:33–40. DOIPubMedGoogle Scholar
  28. Feldman  KS, Foord  A, Heine  HG, Smith  IL, Boyd  V, Marsh  GA, et al. Design and evaluation of consensus PCR assays for henipaviruses. J Virol Methods. 2009;161:52–7. DOIPubMedGoogle Scholar
  29. Yuen  KY, Fraser  NS, Henning  J, Halpin  K, Gibson  JS, Betzien  L, et al. Hendra virus: Epidemiology dynamics in relation to climate change, diagnostic tests and control measures. One Health. 2021;12:100207. DOIPubMedGoogle Scholar
  30. Annand  EJ, Reid  PA. Clinical review of two fatal equine cases of infection with the insectivorous bat strain of Australian bat lyssavirus. Aust Vet J. 2014;92:324–32. DOIPubMedGoogle Scholar
  31. Annand  E, Barr  J, Singanallur Balasubramanian  N, Reid  P, Boyd  V, Burneikienė-Petraitytė  R, et al. Spillover of bat borne Rubulavirus in Australian horses—horses as sentinels for emerging infectious diseases. Int J Infect Dis. 2020;101:401–2. DOIGoogle Scholar
  32. Barr  J, Smith  C, Smith  I, de Jong  C, Todd  S, Melville  D, et al. Isolation of multiple novel paramyxoviruses from pteropid bat urine. J Gen Virol. 2015;96:24–9. DOIPubMedGoogle Scholar
  33. Marsh  GA, de Jong  C, Barr  JA, Tachedjian  M, Smith  C, Middleton  D, et al. Cedar virus: a novel Henipavirus isolated from Australian bats. PLoS Pathog. 2012;8:e1002836. DOIPubMedGoogle Scholar
  34. Vidgen  ME, de Jong  C, Rose  K, Hall  J, Field  HE, Smith  CS. Novel paramyxoviruses in Australian flying-fox populations support host-virus co-evolution. J Gen Virol. 2015;96:1619–25. DOIPubMedGoogle Scholar
  35. Tong  S, Chern  S-WW, Li  Y, Pallansch  MA, Anderson  LJ. Sensitive and broadly reactive reverse transcription-PCR assays to detect novel paramyxoviruses. J Clin Microbiol. 2008;46:2652–8. DOIPubMedGoogle Scholar
  36. Li  D, Liu  C-M, Luo  R, Sadakane  K, Lam  T-W. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics. 2015;31:1674–6. DOIPubMedGoogle Scholar
  37. Altschul  SF, Gish  W, Miller  W, Myers  EW, Lipman  DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10. DOIPubMedGoogle Scholar
  38. Rima  B, Balkema-Buschmann  A, Dundon  WG, Duprex  P, Easton  A, Fouchier  R, et al.; Ictv Report Consortium. ICTV virus taxonomy profile: Paramyxoviridae. J Gen Virol. 2019;100:1593–4. DOIPubMedGoogle Scholar
  39. Crameri  G, Todd  S, Grimley  S, McEachern  JA, Marsh  GA, Smith  C, et al. Establishment, immortalisation and characterisation of pteropid bat cell lines. PLoS One. 2009;4:e8266. DOIPubMedGoogle Scholar
  40. Xu  K, Rockx  B, Xie  Y, DeBuysscher  BL, Fusco  DL, Zhu  Z, et al. Crystal structure of the Hendra virus attachment G glycoprotein bound to a potent cross-reactive neutralizing human monoclonal antibody. PLoS Pathog. 2013;9:e1003684. DOIPubMedGoogle Scholar
  41. Australian Government Department of Agriculture, Water and the Environment. Monitoring flying-fox populations [cited 2021 May 28]. https://www.environment.gov.au/biodiversity/threatened/species/flying-fox-monitoring
  42. Colling  A, Lunt  R, Bergfeld  J, McNabb  L, Halpin  K, Juzva  S, et al. A network approach for provisional assay recognition of a Hendra virus antibody ELISA: test validation with low sample numbers from infected horses. J Vet Diagn Invest. 2018;30:362–9. DOIPubMedGoogle Scholar
  43. Hyatt  AD, Zaki  SR, Goldsmith  CS, Wise  TG, Hengstberger  SG. Ultrastructure of Hendra virus and Nipah virus within cultured cells and host animals. Microbes Infect. 2001;3:297–306. DOIPubMedGoogle Scholar
  44. Laing  E, Yan  L, Sterling  S, Broder  C. A Luminex-based multiplex assay for the simultaneous detection of glycoprotein specific antibodies to ebolaviruses, marburgviruses, and henipaviruses. Int J Infect Dis. 2016;53:108–9. DOIGoogle Scholar
  45. Wang  J, Anderson  D, Valdeter  S, Chen  H, Walker  S, Meehan  B, et al. A novel henipavirus in bats, Australia. In: Proceedings of the One Health EcoHealth Congress. One Health EcoHealth, 4–7 Dec 2016; Melbourne, Australia [cited 2021 Feb 18]. https://publications.csiro.au/rpr/pub?pid=csiro:EP173003
  46. Wang  J, Anderson  DE, Halpin  K, Hong  X, Chen  H, Walker  S, et al. A new Hendra virus genotype found in Australian flying foxes. Virol J. 2021;18:197. DOIPubMedGoogle Scholar
  47. Roberts  BJ, Catterall  CP, Eby  P, Kanowski  J. Latitudinal range shifts in Australian flying-foxes: a re-evaluation. Austral Ecol. 2012;37:12–22. DOIGoogle Scholar
  48. Mendez  DH, Judd  J, Speare  R. Unexpected result of Hendra virus outbreaks for veterinarians, Queensland, Australia. Emerg Infect Dis. 2012;18:83–5. DOIPubMedGoogle Scholar
  49. Animal Health Australia. Australia Veterinary Emergency Plan AUSVETPLAN, Response policy brief Hendra virus infection, version 4.0. Animal Health Australia; 2016 [cited 2021 May 5]. https://animalhealthaustralia.com.au/ausvetplan/download/5621

Main Article

1These authors contributed equally to this article.

2These senior authors contributed equally to this article.

Page created: December 30, 2021
Page updated: February 21, 2022
Page reviewed: February 21, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external