Volume 29, Number 8—August 2023
Dispatch
Candidatus Neoehrlichia mikurensis Infection in Patient with Antecedent Hematologic Neoplasm, Spain1
Table 1
PCR primer pairs and conditions used in study of Candidatus Neoehrlichia mikurensis infection in patient with antecedent hematologic neoplasm, Spain*
| Organisms | Target gene | Primer name | Primer sequence, 5′ → 3′ | Amplicon size | Tm, °C |
|---|---|---|---|---|---|
| Bacteria |
16S rRNA |
fD1 | AGAGTTTGATCCTGGCTCAG | 1,500 bp |
60 |
| rP2 |
ACGGCTACCTTGTTACGACTT |
||||
| Anaplasmataceae† |
16S rRNA-EHR |
EHR16SD | GGTACCYACAGAAGAAGTCC | 345 bp |
55 |
| EHR16SR |
TAGCACTCATCGTTTACAGC |
||||
| Anaplasma phagocytophilum |
msp2 |
msp2–3F | CCAGCGTTTAGCAAGATAAGAG | 334 bp |
56 |
| msp2–3R |
GCCCAGTAACAACATCATAAGC |
||||
| Candidatus N. mikurensis | groEL, 1st run |
Ne-groEL-F | GAAGTATAGTTTAGTATTTTTGTC | 1,275 bp |
49 |
| Ne-groEL-R |
TTAACTTCTACTTCGCTTG |
||||
| groEL, 2nd run |
Ne-groEL-F | GAAGTATAGTTTAGTATTTTTGTC | 510 bp |
49 |
|
| Ne-groEL_ne-1 |
ACATCACGTTTCATAGAA |
||||
| groEL, 2nd run |
Ne-groEL_ne-2 | AAAGGAATTAGTATTAGAATCTTT | 569 bp |
49 |
|
| Ne-groEL_ne-4 |
CTTCCATTTTAACTGCTAA |
||||
| groEL, 2nd run | Ne-groEL_ne-3 | AATATAGCAAGATCAGGTAGAC | 461 bp | 49 | |
| Ne-groEL-R | TTAACTTCTACTTCGCTTG |
*Tm, melting temperature. †Includes Anaplasma, Ehrlichia, and Candidatus Neoehrlichia spp. 16S rRNA-EHR refers to the 16S rRNA sequence from the Anaplasmataceae family members, whereas 16S rRNA refers to the panbacterial 16S rRNA sequence.
1Data from this study were presented at the joint LXIV National Conference of the Spanish Society of Hematology and Hemotherapy, XXXVIII National Conference of the Spanish Society of Thrombosis and Hemostasis, and 38th World Congress of the International Society of Hematology; October 6–8, 2022; Barcelona, Spain; and International Intracellular Bacteria Meeting; August 23–26, 2022; Lausanne, Switzerland.
2These first authors contributed equally to this article.
3Current affiliation: Hospital Universitario San Agustín, Asturias, Spain.