Disclaimer: Early release articles are not considered as final versions. Any changes will be reflected in the online version in the month the article is officially released.
Volume 32, Number 10—October 2026
Research
Persistent Bartonella quintana Infection in Macaques at Primate Research Institute, Japan
Table 2
Primer information for nested PCR targeting the rpoB gene used for study of persistent Bartonella quintana infection in macaques at primate research institute, Japan*
| Use application | Primer | Nucleotide sequences, 5′ → 3′ | Amplicon size, bp | Reference |
|---|---|---|---|---|
| 1st PCR | 1913f | ACGCTGAGGGACGTTTTACAG | 445 | This study |
| 2357r |
ACATGCACGAGAGGACGCTG |
|||
| 2nd PCR | 600f-m | GAAAATGATGATGCRAATCG | 211 | 22 |
| 800r-m | GATCTAAATCTTCTGTRGCACG |
References
- List of prokaryotic names with standing in nomenclature. Genus Bartonella [cited 2026 Jan 11]. https://lpsn.dsmz.de/genus/Bartonella
- Tsai YL, Chang CC, Chuang ST, Chomel BB. Bartonella species and their ectoparasites: selective host adaptation or strain selection between the vector and the mammalian host? Comp Immunol Microbiol Infect Dis. 2011;34:299–314. DOIPubMedGoogle Scholar
- Qiu Y, Kajihara M, Nakao R, Mulenga E, Harima H, Hang’ombe BM, et al. Isolation of Candidatus Bartonella rousetti and other bat-associated Bartonellae from bats and their flies in Zambia. Pathogens. 2020;9:469. DOIPubMedGoogle Scholar
- Ciceroni L, Fabbi M, Ciarrocchi S, Pinto A, Ciervo A, Kasten RW, et al. Characterization of the first Bartonella henselae strain isolated from a cat in Italy. Comp Immunol Microbiol Infect Dis. 2002;25:217–28. DOIPubMedGoogle Scholar
- Sato S, Kabeya H, Yamazaki M, Takeno S, Suzuki K, Kobayashi S, et al. Prevalence and genetic diversity of Bartonella species in sika deer (Cervus nippon) in Japan. Comp Immunol Microbiol Infect Dis. 2012;35:575–81. DOIPubMedGoogle Scholar
- Gonçalves-Oliveira J, Gutierrez R, Schlesener CL, Jaffe DA, Aguilar-Setién A, Boulouis HJ, et al. Genomic characterization of three novel Bartonella strains in a rodent and two bat species from Mexico. Microorganisms. 2023;11:340. DOIPubMedGoogle Scholar
- Deng H, Pang Q, Zhao B, Vayssier-Taussat M. Molecular mechanisms of Bartonella and mammalian erythrocyte interactions: a review. Front Cell Infect Microbiol. 2018;8:431. DOIPubMedGoogle Scholar
- Maurin M, Raoult D. Bartonella (Rochalimaea) quintana infections. Clin Microbiol Rev. 1996;9:273–92. DOIPubMedGoogle Scholar
- Spach DH, Kanter AS, Dougherty MJ, Larson AM, Coyle MB, Brenner DJ, et al. Bartonella (Rochalimaea) quintana bacteremia in inner-city patients with chronic alcoholism. N Engl J Med. 1995;332:424–8. DOIPubMedGoogle Scholar
- Brouqui P, Lascola B, Roux V, Raoult D. Chronic Bartonella quintana bacteremia in homeless patients. N Engl J Med. 1999;340:184–9. DOIPubMedGoogle Scholar
- Foucault C, Barrau K, Brouqui P, Raoult D. Bartonella quintana bacteremia among homeless people. Clin Infect Dis. 2002;35:684–9. DOIPubMedGoogle Scholar
- Capo C, Amirayan-Chevillard N, Brouqui P, Raoult D, Mege JL. Bartonella quintana bacteremia and overproduction of interleukin-10: model of bacterial persistence in homeless people. J Infect Dis. 2003;187:837–44. DOIPubMedGoogle Scholar
- Sasaki T, Adachi T, Itoh K, Matsuoka M, Yamagishi T, Hirao M, et al. Detection of Bartonella quintana infection among the homeless population in Tokyo, Japan, from 2013–2015. Jpn J Infect Dis. 2021;74:411–5. DOIPubMedGoogle Scholar
- Rolain JM, Foucault C, Guieu R, La Scola B, Brouqui P, Raoult D. Bartonella quintana in human erythrocytes. Lancet. 2002;360:226–8. DOIPubMedGoogle Scholar
- Kostrzewski J. The epidemiology of trench fever [in Polish]. Bull Int Acad Pol Sci Let Cl Med. 1949;7:233–63.PubMedGoogle Scholar
- Vinson JW, Varela G, Molina-Pasquel C. Trench fever. Am J Trop Med Hyg. 1969;18:713–22. DOIPubMedGoogle Scholar
- O’Rourke LG, Pitulle C, Hegarty BC, Kraycirik S, Killary KA, Grosenstein P, et al. Bartonella quintana in cynomolgus monkey (Macaca fascicularis). Emerg Infect Dis. 2005;11:1931–4. DOIPubMedGoogle Scholar
- Huang R, Liu Q, Li G, Li D, Song X, Birtles RJ, et al. Bartonella quintana infections in captive monkeys, China. Emerg Infect Dis. 2011;17:1707–9. DOIPubMedGoogle Scholar
- Li H, Bai JY, Wang LY, Zeng L, Shi YS, Qiu ZL, et al. Genetic diversity of Bartonella quintana in macaques suggests zoonotic origin of trench fever. Mol Ecol. 2013;22:2118–27. DOIPubMedGoogle Scholar
- Sato S, Kabeya H, Yoshino A, Sekine W, Suzuki K, Tamate HB, et al. Japanese macaques (Macaca fuscata) as natural reservoir of Bartonella quintana. Emerg Infect Dis. 2015;21:2168–70. DOIPubMedGoogle Scholar
- Sato S, Nishioka E, Kabeya H, Maruyama S. Genomic properties of a Bartonella quintana strain from Japanese macaque (Macaca fuscata) revealed by genome comparison with human and rhesus macaque strains. Sci Rep. 2024;14:10941. DOIPubMedGoogle Scholar
- Gutiérrez R, Morick D, Gross I, Winkler R, Abdeen Z, Harrus S. Bartonellae in domestic and stray cats from Israel: comparison of bacterial cultures and high-resolution melt real-time PCR as diagnostic methods. Vector Borne Zoonotic Dis. 2013;13:857–64. DOIPubMedGoogle Scholar
- Kabeya H, Inoue K, Izumi Y, Morita T, Imai S, Maruyama S. Bartonella species in wild rodents and fleas from them in Japan. J Vet Med Sci. 2011;73:1561–7. DOIPubMedGoogle Scholar
- Norman AF, Regnery R, Jameson P, Greene C, Krause DC. Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene. J Clin Microbiol. 1995;33:1797–803. DOIPubMedGoogle Scholar
- Roux V, Raoult D. The 16S-23S rRNA intergenic spacer region of Bartonella (Rochalimaea) species is longer than usually described in other bacteria. Gene. 1995;156:107–11. DOIPubMedGoogle Scholar
- Souvorov A, Agarwala R, Lipman DJ. SKESA: strategic k-mer extension for scrupulous assemblies. Genome Biol. 2018;19:153. DOIPubMedGoogle Scholar
- Simão FA, Waterhouse RM, Ioannidis P, Kriventseva EV, Zdobnov EM. M Simão FA. BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics. 2015;31:3210–2. DOIPubMedGoogle Scholar
- Richter M, Rosselló-Móra R, Oliver Glöckner F, Peplies J. JSpeciesWS: a web server for prokaryotic species circumscription based on pairwise genome comparison. Bioinformatics. 2016;32:929–31. DOIPubMedGoogle Scholar
- Meier-Kolthoff JP, Carbasse JS, Peinado-Olarte RL, Göker M. TYGS and LPSN: a database tandem for fast and reliable genome-based classification and nomenclature of prokaryotes. Nucleic Acids Res. 2022;50(D1):D801–7. DOIPubMedGoogle Scholar
- Li H, Liu W, Zhang GZ, Sun ZZ, Bai JY, Jiang BG, et al. Transmission and maintenance cycle of Bartonella quintana among rhesus macaques, China. Emerg Infect Dis. 2013;19:297–300. DOIPubMedGoogle Scholar
- Okaro U, Addisu A, Casanas B, Anderson B. Bartonella species, an emerging cause of blood-culture-negative endocarditis. Clin Microbiol Rev. 2017;30:709–46. DOIPubMedGoogle Scholar
- Alsmark CM, Frank AC, Karlberg EO, Legault BA, Ardell DH, Canbäck B, et al. The louse-borne human pathogen Bartonella quintana is a genomic derivative of the zoonotic agent Bartonella henselae. Proc Natl Acad Sci U S A. 2004;101:9716–21. DOIPubMedGoogle Scholar
Page created: August 05, 2026
Page updated: September 17, 2026
Page reviewed: September 17, 2026
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.