Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Disclaimer: Early release articles are not considered as final versions. Any changes will be reflected in the online version in the month the article is officially released.

Volume 32, Number 10—October 2026

Research

Persistent Bartonella quintana Infection in Macaques at Primate Research Institute, Japan

Yoshiki Nomura, Yuka Fukudome, Akihiro Homma, Tadashi Sankai, Munehiro Okamoto, Hidenori Kabeya, Soichi Maruyama, and Shingo SatoComments to Author 
Author affiliation: Nihon University, Fujisawa, Japan (Y. Nomura, Y. Fukudome, A. Homma, H. Kabeya, S. Maruyama, S. Sato); Yokohama City University Graduate School of Medicine, Yokohama, Japan (T. Sankai); Kyoto University Primate Research Institute, Inuyama, Japan (M. Okamoto)

Main Article

Table 2

Primer information for nested PCR targeting the rpoB gene used for study of persistent Bartonella quintana infection in macaques at primate research institute, Japan*

Use application Primer Nucleotide sequences, 5′ → 3′ Amplicon size, bp Reference
1st PCR 1913f ACGCTGAGGGACGTTTTACAG 445 This study
2357r
 ACATGCACGAGAGGACGCTG
2nd PCR 600f-m GAAAATGATGATGCRAATCG 211 22
800r-m GATCTAAATCTTCTGTRGCACG

Main Article

References
  1. List of prokaryotic names with standing in nomenclature. Genus Bartonella [cited 2026 Jan 11]. https://lpsn.dsmz.de/genus/Bartonella
  2. Tsai  YL, Chang  CC, Chuang  ST, Chomel  BB. Bartonella species and their ectoparasites: selective host adaptation or strain selection between the vector and the mammalian host? Comp Immunol Microbiol Infect Dis. 2011;34:299–314. DOIPubMedGoogle Scholar
  3. Qiu  Y, Kajihara  M, Nakao  R, Mulenga  E, Harima  H, Hang’ombe  BM, et al. Isolation of Candidatus Bartonella rousetti and other bat-associated Bartonellae from bats and their flies in Zambia. Pathogens. 2020;9:469. DOIPubMedGoogle Scholar
  4. Ciceroni  L, Fabbi  M, Ciarrocchi  S, Pinto  A, Ciervo  A, Kasten  RW, et al. Characterization of the first Bartonella henselae strain isolated from a cat in Italy. Comp Immunol Microbiol Infect Dis. 2002;25:217–28. DOIPubMedGoogle Scholar
  5. Sato  S, Kabeya  H, Yamazaki  M, Takeno  S, Suzuki  K, Kobayashi  S, et al. Prevalence and genetic diversity of Bartonella species in sika deer (Cervus nippon) in Japan. Comp Immunol Microbiol Infect Dis. 2012;35:575–81. DOIPubMedGoogle Scholar
  6. Gonçalves-Oliveira  J, Gutierrez  R, Schlesener  CL, Jaffe  DA, Aguilar-Setién  A, Boulouis  HJ, et al. Genomic characterization of three novel Bartonella strains in a rodent and two bat species from Mexico. Microorganisms. 2023;11:340. DOIPubMedGoogle Scholar
  7. Deng  H, Pang  Q, Zhao  B, Vayssier-Taussat  M. Molecular mechanisms of Bartonella and mammalian erythrocyte interactions: a review. Front Cell Infect Microbiol. 2018;8:431. DOIPubMedGoogle Scholar
  8. Maurin  M, Raoult  D. Bartonella (Rochalimaea) quintana infections. Clin Microbiol Rev. 1996;9:273–92. DOIPubMedGoogle Scholar
  9. Spach  DH, Kanter  AS, Dougherty  MJ, Larson  AM, Coyle  MB, Brenner  DJ, et al. Bartonella (Rochalimaea) quintana bacteremia in inner-city patients with chronic alcoholism. N Engl J Med. 1995;332:424–8. DOIPubMedGoogle Scholar
  10. Brouqui  P, Lascola  B, Roux  V, Raoult  D. Chronic Bartonella quintana bacteremia in homeless patients. N Engl J Med. 1999;340:184–9. DOIPubMedGoogle Scholar
  11. Foucault  C, Barrau  K, Brouqui  P, Raoult  D. Bartonella quintana bacteremia among homeless people. Clin Infect Dis. 2002;35:684–9. DOIPubMedGoogle Scholar
  12. Capo  C, Amirayan-Chevillard  N, Brouqui  P, Raoult  D, Mege  JL. Bartonella quintana bacteremia and overproduction of interleukin-10: model of bacterial persistence in homeless people. J Infect Dis. 2003;187:837–44. DOIPubMedGoogle Scholar
  13. Sasaki  T, Adachi  T, Itoh  K, Matsuoka  M, Yamagishi  T, Hirao  M, et al. Detection of Bartonella quintana infection among the homeless population in Tokyo, Japan, from 2013–2015. Jpn J Infect Dis. 2021;74:411–5. DOIPubMedGoogle Scholar
  14. Rolain  JM, Foucault  C, Guieu  R, La Scola  B, Brouqui  P, Raoult  D. Bartonella quintana in human erythrocytes. Lancet. 2002;360:226–8. DOIPubMedGoogle Scholar
  15. Kostrzewski  J. The epidemiology of trench fever [in Polish]. Bull Int Acad Pol Sci Let Cl Med. 1949;7:233–63.PubMedGoogle Scholar
  16. Vinson  JW, Varela  G, Molina-Pasquel  C. Trench fever. Am J Trop Med Hyg. 1969;18:713–22. DOIPubMedGoogle Scholar
  17. O’Rourke  LG, Pitulle  C, Hegarty  BC, Kraycirik  S, Killary  KA, Grosenstein  P, et al. Bartonella quintana in cynomolgus monkey (Macaca fascicularis). Emerg Infect Dis. 2005;11:1931–4. DOIPubMedGoogle Scholar
  18. Huang  R, Liu  Q, Li  G, Li  D, Song  X, Birtles  RJ, et al. Bartonella quintana infections in captive monkeys, China. Emerg Infect Dis. 2011;17:1707–9. DOIPubMedGoogle Scholar
  19. Li  H, Bai  JY, Wang  LY, Zeng  L, Shi  YS, Qiu  ZL, et al. Genetic diversity of Bartonella quintana in macaques suggests zoonotic origin of trench fever. Mol Ecol. 2013;22:2118–27. DOIPubMedGoogle Scholar
  20. Sato  S, Kabeya  H, Yoshino  A, Sekine  W, Suzuki  K, Tamate  HB, et al. Japanese macaques (Macaca fuscata) as natural reservoir of Bartonella quintana. Emerg Infect Dis. 2015;21:2168–70. DOIPubMedGoogle Scholar
  21. Sato  S, Nishioka  E, Kabeya  H, Maruyama  S. Genomic properties of a Bartonella quintana strain from Japanese macaque (Macaca fuscata) revealed by genome comparison with human and rhesus macaque strains. Sci Rep. 2024;14:10941. DOIPubMedGoogle Scholar
  22. Gutiérrez  R, Morick  D, Gross  I, Winkler  R, Abdeen  Z, Harrus  S. Bartonellae in domestic and stray cats from Israel: comparison of bacterial cultures and high-resolution melt real-time PCR as diagnostic methods. Vector Borne Zoonotic Dis. 2013;13:857–64. DOIPubMedGoogle Scholar
  23. Kabeya  H, Inoue  K, Izumi  Y, Morita  T, Imai  S, Maruyama  S. Bartonella species in wild rodents and fleas from them in Japan. J Vet Med Sci. 2011;73:1561–7. DOIPubMedGoogle Scholar
  24. Norman  AF, Regnery  R, Jameson  P, Greene  C, Krause  DC. Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene. J Clin Microbiol. 1995;33:1797–803. DOIPubMedGoogle Scholar
  25. Roux  V, Raoult  D. The 16S-23S rRNA intergenic spacer region of Bartonella (Rochalimaea) species is longer than usually described in other bacteria. Gene. 1995;156:107–11. DOIPubMedGoogle Scholar
  26. Souvorov  A, Agarwala  R, Lipman  DJ. SKESA: strategic k-mer extension for scrupulous assemblies. Genome Biol. 2018;19:153. DOIPubMedGoogle Scholar
  27. Simão  FA, Waterhouse  RM, Ioannidis  P, Kriventseva  EV, Zdobnov  EM. M Simão FA. BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs. Bioinformatics. 2015;31:3210–2. DOIPubMedGoogle Scholar
  28. Richter  M, Rosselló-Móra  R, Oliver Glöckner  F, Peplies  J. JSpeciesWS: a web server for prokaryotic species circumscription based on pairwise genome comparison. Bioinformatics. 2016;32:929–31. DOIPubMedGoogle Scholar
  29. Meier-Kolthoff  JP, Carbasse  JS, Peinado-Olarte  RL, Göker  M. TYGS and LPSN: a database tandem for fast and reliable genome-based classification and nomenclature of prokaryotes. Nucleic Acids Res. 2022;50(D1):D801–7. DOIPubMedGoogle Scholar
  30. Li  H, Liu  W, Zhang  GZ, Sun  ZZ, Bai  JY, Jiang  BG, et al. Transmission and maintenance cycle of Bartonella quintana among rhesus macaques, China. Emerg Infect Dis. 2013;19:297–300. DOIPubMedGoogle Scholar
  31. Okaro  U, Addisu  A, Casanas  B, Anderson  B. Bartonella species, an emerging cause of blood-culture-negative endocarditis. Clin Microbiol Rev. 2017;30:709–46. DOIPubMedGoogle Scholar
  32. Alsmark  CM, Frank  AC, Karlberg  EO, Legault  BA, Ardell  DH, Canbäck  B, et al. The louse-borne human pathogen Bartonella quintana is a genomic derivative of the zoonotic agent Bartonella henselae. Proc Natl Acad Sci U S A. 2004;101:9716–21. DOIPubMedGoogle Scholar

Main Article

Page created: August 05, 2026
Page updated: September 17, 2026
Page reviewed: September 17, 2026
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external