Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 5, Number 1—February 1999
Research

Genetic Diversity and Distribution of Peromyscus-Borne Hantaviruses in North America

Martha C. Monroe*, Sergey P. Morzunov†, Angela M. Johnson*, Michael D. Bowen*, Harvey Artsob‡, Terry Yates§, C.J. Peters*, Pierre E. Rollin*, Thomas G. Ksiazek*, and Stuart T. Nichol*Comments to Author 
Author affiliations: *Centers for Disease Control and Prevention, Atlanta, Georgia, USA;; †University of Nevada, Reno, Nevada, USA;; ‡Laboratory Centre for Disease Control, Federal Laboratories, Winnipeg, Manitoba, Canada;; §University of New Mexico, Albuquerque, New Mexico, USA

Main Article

Table 2

PCR and sequencing primers

1st-round primers (5' to 3') 2nd-round primers (5' to 3') Basis of primer design (ref.) Amplicon size
TTTAAGCAATGGTG(C/T)ACTAC(T/A)AC AGAAAGAAATGTGCATTTGC Puumala/ Prospect Hill/ 278
CCATAACACAT(A/T)GCAGC CCTGAACCCCATGC(A/T/C)CCATC Arvicolinae (2)
TTTAAGCAATGGTG(C/T)ACTAC(T/A)AC AAGGTAACACAGT(G/C)TCTGGATTC Sin Nombre/ Western 185
CCATAACACAT(A/T)GCAGC GGTTATCACTTAGATC(C/T)TGAAAGG U.S. 1st generation (2)
AGAAAGATCTGTGGGTTTGC AAGGTAACACAGT(G/C)TCTGGATTC Sin Nombre/ Western 185
CCTGAACCCCAGGCCCCGT GGTTATCACTTAGATC(C/T)TGAAAGG U.S. 2nd generation (11)
TGTGTGTTTGGAGACCCTGG ATGTCAACAAC(A/G)AGTGGGATG Sin Nombre Nevada/ 185
TC(A/G)ATAGATTGTGTATGCA CATGGGTTATCACTTAG(G/A)TC E. California (31)
CAGAAAGATCTGCGGGTTTGC CAAGGGAATACTGTCTCTGGATTT Bayou virus/LA/ 185
CCCGAGCCCCATGCACCAT GATTGTCACTCAGATCTTGAAATG East Coast/ S. American (19,20)
TGTGAITATCAAGGIAAIAC TGTGAITATCAAGGIAAIAC General Sigmodontinae 242
ACIG(A/T)IGCICCATAICACAT CCCCAIGCICCITCAAT (10)

Main Article

References
  1. McKee  KT Jr, LeDuc  JW, Peters  CJ. Hantaviruses. In: Belshe RB, editor. Textbook of human virology. 2nd ed. St. Louis (MO): Mosby; 1991. p. 615-32.
  2. Nichol  ST, Spiropoulou  CF, Morzunov  SP, Rollin  PE, Ksiazek  TG, Feldmann  H, Genetic identification of a hantavirus associated with an outbreak of acute respiratory illness. Science. 1993;262:914–7. DOIPubMedGoogle Scholar
  3. Childs  JE, Ksiazek  TG, Spiropoulou  CF, Krebs  JW, Morzunov  S, Maupin  GO, Serologic and genetic identification of Peromyscus maniculatus as the primary rodent reservoir for a new hantavirus in the southwestern United States. J Infect Dis. 1994;169:127–80.PubMedGoogle Scholar
  4. Duchin  JS, Koster  FT, Peters  CJ, Simpson  GL, Tempest  B, Zaki  SR, Hantavirus pulmonary syndrome: a clinical description of 17 patients with a newly recognized disease. N Engl J Med. 1994;330:949–55. DOIPubMedGoogle Scholar
  5. Schmaljohn  C, Hjelle  B. Hantaviruses: a global disease problem. Emerg Infect Dis. 1997;3:95–104. DOIPubMedGoogle Scholar
  6. Tsai  TF, Bauer  SP, Sasso  DR, Whitfield  SG, McCormick  JB, Caraway  CT, Serological and virological evidence of a Hantaan virus-related enzootic in the United States. J Infect Dis. 1985;152:126–36.PubMedGoogle Scholar
  7. Yanagihara  R, Daum  CA, Lee  P-W, Baek  L-J, Amyx  HL, Gajdusek  DC, Serological survey of Prospect Hill virus infection in indigenous wild rodents in the USA. Trans R Soc Trop Med Hyg. 1987;81:42–5. DOIPubMedGoogle Scholar
  8. Mills  JN, Johnson  JM, Ksiazek  TG, Ellis  BA, Rollin  PE, Yates  TL, Patterns of association with host and habitat: Antibody reactive with Sin Nombre virus in small mammals in the major biotic communities of the southwestern United States. Am J Trop Med Hyg. 1997;56:273–84.PubMedGoogle Scholar
  9. Mills  JN, Johnson  JM, Ksiazek  TG, Ellis  BA, Rollin  PE, Yates  TL, A survey of hantavirus antibody in small-mammal populations in selected United States national parks. Am J Trop Med Hyg. 1998;58:525–32.PubMedGoogle Scholar
  10. Johnson  AM, Bowen  MD, Ksiazek  TG, Williams  RJ, Bryan  RT, Mills  JN, Laguna Negra virus associated with HPS in western Paraguay and Bolivia. Virology. 1997;238:115–27. DOIPubMedGoogle Scholar
  11. Spiropoulou  CF, Morzunov  S, Feldmann  H, Sanchez  A, Peters  CJ, Nichol  ST. Genome structure and variability of a virus causing hantavirus pulmonary syndrome. Virology. 1994;200:715–23. DOIPubMedGoogle Scholar
  12. Swofford  DL. PAUP*: phylogenetic analysis using parsimony (*and other methods) [computer program]. Version 4.0. Sinauer, Sunderland, MA; 1998.
  13. Hillis  DM, Bull  JJ. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst Biol. 1993;42:182–92.
  14. Lee  P, Amyx  HL, Yanagihata  R, Gajdusek  DC, Goldgaber  D, Gibbs  CJ Jr. Partial characterization of Prospect Hill virus isolated from meadow voles in the United States. J Infect Dis. 1985;152:826–9.PubMedGoogle Scholar
  15. Parrington  MA, Lee  PW, Kang  CY. Molecular characterization of the Prospect Hill virus M RNA segment: comparison with the M RNA segments of other hantaviruses. J Gen Virol. 1991;72:1845–54. DOIPubMedGoogle Scholar
  16. Rowe  JE, St Jeor  SC, Riolo  J, Otteson  EW, Monroe  MC, Ksiazek  TG, Coexistence of several novel hantaviruses in rodents indigenous to North America. Virology. 1995;213:122–30. DOIPubMedGoogle Scholar
  17. Song  W, Torrez-Martinez  N, Irwin  W, Harrison  FJ, Davis  R, Ascher  M, Isla Vista virus: a genetically novel hantavirus of the California vole Microtus californicus. J Gen Virol. 1995;76:3195–9. DOIPubMedGoogle Scholar
  18. Rawlings  JA, Torrez-Martinez  N, Neill  SU, Moore  GM, Hicks  BN, Pichuantes  S, Cocirculation of multiple hantaviruses in Texas, with characterization of the small (S) genome of a previously undescribed virus of cotton rats (Sigmodon hispidus). Am J Trop Med Hyg. 1996;55:672–9.PubMedGoogle Scholar
  19. Fulhorst  CF, Monroe  MC, Salas  RA, Duno  G, Utrera  A, Ksiazek  TG, Isolation, characterization, and geographic distribution of Caño Delgadito virus, a newly discovered South American hantavirus (family Bunyaviridae). Virus Res. 1997;51:159–71. DOIPubMedGoogle Scholar
  20. Morzunov  SP, Feldmann  H, Spiropoulou  CF, Semenova  VA, Rollin  PE, Ksiazek  TG, A newly recognized virus associated with a fatal case of hantavirus pulmonary syndrome in Louisiana. J Virol. 1995;69:1980–3.PubMedGoogle Scholar
  21. Ksiazek  TG, Nichol  ST, Mills  JN, Groves  MG, Wozniak  A, McAdams  S, Isolation, genetic diversity and geographic distribution of Bayou virus. Am J Trop Med Hyg. 1997;57:445–8.PubMedGoogle Scholar
  22. Hjelle  B, Goade  D, Torrez-Martinez  N, Lang-Williams  M, Kim  J, Harris  RL, Hantavirus pulmonary syndrome, renal insufficiency and myositis associated with infection by Bayou hantavirus. Clin Infect Dis. 1996;23:495–500.PubMedGoogle Scholar
  23. Hjelle  B, Chavez-Giles  F, Torrez-Martinez  N, Yates  T, Sarisky  J, Webb  J, Genetic identification of a novel hantavirus of the harvest mouse Reithrodontomys megalotis. J Virol. 1994;68:6751–4.PubMedGoogle Scholar
  24. Torrez-Martinez  N, Song  W, Hjelle  B. Nucleotide sequence analysis of the M genomic segment of El Moro Canyon hantavirus: antigenic distinction from Four Corners hantavirus. Virology. 1995;211:336–8. DOIPubMedGoogle Scholar
  25. Nichol  ST, Ksiazek  TG, Rollin  PE, Peters  CJ. Hantavirus pulmonary syndrome and newly described hantaviruses in the United States. In: Elliott RM, editor. The Bunyaviridae. New York: Plenum Press; 1996. p. 269-80.
  26. da Silva  MV, Vasconcelos  MJ, Hidalgo  NTR, Veiga  APR, Canzian  M, Marotto  PCF, Rev Inst Med Trop Sao Paulo. 1997;39:231–4.PubMedGoogle Scholar
  27. Vasconcelos  MJ, Lima  VP, Iversson  LB, Rosa  MDB, Travassos Da Rosa  APA, Travassos Da Rosa  ES, Pulmonary syndrome in the rural area of Juquitiba, São Paulo metropolitan area, Brazil. Rev Inst Med Trop Sao Paulo. 1997;39:237–8.PubMedGoogle Scholar
  28. Lopez  N, Padula  P, Rossi  C, Lazaro  ME, Franze-Fernandez  MT. Genetic identification of a new hantavirus causing severe pulmonary syndrome in Argentina. Virology. 1996;220:223–6. DOIPubMedGoogle Scholar
  29. Levis  S, Rowe  JE, Morzunov  S, Enria  DA, St Jeor  S. New hantavirus causing hantavirus pulmonary syndrome in central Argentina. Lancet. 1997;349:998–9. DOIPubMedGoogle Scholar
  30. Williams  RJ, Bryan  RT, Mills  JN, Palma  RE, Vera  I, de Velasquez  F, An outbreak of hantavirus pulmonary syndrome in western Paraguay. Am J Trop Med Hyg. 1997;57:274–82.PubMedGoogle Scholar
  31. Henderson  WW, Monroe  MC, St Jeor  SC, Thayer  WP, Rowe  JE, Peters  CJ, Naturally occurring Sin Nombre virus genetic reassortants. Virology. 1995;213:602–10. DOIGoogle Scholar
  32. Nerurkar  VR, Song  JW, Song  KJ, Nagle  JW, Hjelle  B, Jenison  S, Genetic evidence for a hantavirus enzootic in deer mice (Peromyscus maniculatus) captured a decade before the recognition of hantavirus pulmonary syndrome. Virology. 1994;204:563–8. DOIPubMedGoogle Scholar
  33. Zaki  SR, Khan  AS, Goodman  RA, Armstrong  LR, Greer  PW, Coffield  LM, Retrospective diagnosis of hantavirus pulmonary syndrome, 1978-1993—Implications for emerging infectious diseases. Arch Pathol Lab Med. 1996;120:134–9.PubMedGoogle Scholar
  34. Hjelle  B, Lee  SW, Song  W, Torrez-Martinez  N, Song  JW, Yanagihara  R, Molecular linkage of hantavirus pulmonary syndrome to the white-footed mouse, Peromyscus leucopus: genetic characterization of the M genome of New York virus. J Virol. 1995;69:8137–41.PubMedGoogle Scholar
  35. Hall  ER. Mammals of North America. New York: John Wiley and Sons; 1981.
  36. Song  JW, Baek  LJ, Nagle  JW, Schlitter  D, Yanagihara  R. Genetic and phylogenetic analyses of hantaviral sequences amplified from archival tissues of deer mice (Peromyscus maniculatus nubiterrae) captured in the eastern United States. Arch Virol. 1996;141:959–67. DOIPubMedGoogle Scholar
  37. Morzunov  SP, Rowe  JE, Ksiazek  TG, Peters  CJ, St Jeor  SC, Nichol  ST. Genetic analysis of the diversity and origin of hantaviruses in Peromyscus leucopus mice in North America. J Virol. 1998;72:57–64.PubMedGoogle Scholar
  38. Schmaljohn  AL, Li  D, Negley  DL, Bressler  DS, Turell  MJ, Korch  GW, Isolation and initial characterization of a new found hantavirus from California. Virology. 1995;206:963–72. DOIPubMedGoogle Scholar
  39. Rodriguez  LL, Owens  JH, Peters  CJ, Nichol  ST. Genetic reassortment among viruses causing hantavirus pulmonary syndrome. Virology. 1998;242:99–106. DOIPubMedGoogle Scholar

Main Article

Page created: December 10, 2010
Page updated: December 10, 2010
Page reviewed: December 10, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external