Volume 13, Number 9—September 2007
Dispatch
Anaplasma platys in Dogs, Chile
Table 1
Ehrlichia/Anaplasma spp. (primer type) | Primer | Primer sequence (5′→3′) | Region | Reference |
---|---|---|---|---|
Ehrlichia spp., A. phagocytophilum, E. canis, E. chaffeensis, E. ewingii, A. platys (outer) | EHR-OUT1 | CTGGCGGCAAGCCTAACACATGCCAACAT | 16S rRNA | (5) |
EHR-OUT2 | GCTCGTTGCGGGACTTAACCCAACATCTCACGAC | 16S rRNA | (5) | |
Ehrlichia spp. (inner) | GE2F | GTTAGTGGCATACGGGTGAAT | 16S rRNA | (5) |
EHRL3-IP2 | TCATCTAATAGCGATAAATC | 16S rRNA | (5) | |
A. phagocytophilum (inner) | ge9f | AACGGATTATTCTTTATAGCTTGCT | 16S rRNA | (6) |
ge2 | GGCAGTATTAAAAGCAGCTCCAGG | 16S rRNA | (6) | |
E. canis, E. chaffeensis, E. ewingii (inner) | HE3-R | CTTCTATAGGTACCGTCATTATCTTCCCTAT | 16S rRNA | (5) |
E. canis (inner) | E. canis | CAATTATTTATAGCCTCTGGCTATAGGAA | 16S rRNA | (5) |
E. chaffeensis (inner) | E. chaffeensis | CAATTGCTTATAACCTTTTGGTTATAAATA | 16S rRNA | (5) |
E. ewingii (inner) | E. ewingii | CAATTCCTAAATAGTCTCTGACTATT | 16S rRNA | (5) |
E. equi (inner) | E. equi-3-IP2 | GTCGAACGGATTATTCTTTATAGCTTG | 16S rRNA | (5) |
E. platys (inner) | EHRL3-IP2 | TCATCTAATAGCGATAAATC | 16S rRNA | (5,7) |
E. platys | GATTTTTGTCGTAGCTTGCTA | 16S rRNA | (7) | |
E. platys (outer) | EEgro1F | GAGTTCGACGGTAAGAAGTTCA | groESL | (8) |
EEgro2R | CAGCGTCGTTCTTACTAGGAAC | groESL | (8) | |
A. platys (inner) | SQ3F | ATTAGCAAGCCTTATGGGTC | groESL | (9) |
SQ5F | TCAGTGTGTGAAGGAAGTTG | groESL | (9) | |
SQ4R | CTTTAGGCTATCAAGAGATG | groESL | (9) | |
SQ6R | TGCTTCCTATGTTCTTATCG | groESL | (9) |
References
- González-Acuña D, Guglielmone AA. Ticks (Acari: Ixodoidea: Argasidae, Ixodidae) of Chile. Exp Appl Acarol. 2005;35:147–63. DOIPubMedGoogle Scholar
- Sanogo YO, Davoust B, Inokuma H, Camicas JL, Parola P, Brouqui P. First evidence of Anaplasma platys in Rhipicephalus sanguineus (Acari: Ixodida) collected from dogs in Africa. Onderstepoort J Vet Res. 2003;70:205–12.PubMedGoogle Scholar
- López J, Castillo A, Muñoz M, Hildebrand S. Hallazgo de Ehrlichia canis en Chile, informe preliminar. Archivos de Medicina Veterinaria. 1999;31:211–4. DOIGoogle Scholar
- López J, Rivera M, Concha JC, Gatica S, Loeffeholz M, Barriga O. Serologic evidence for human ehrlichiosis in Chile. Rev Med Chil. 2003;131:67–70.PubMedGoogle Scholar
- Breitschwerdt EB, Hegarty BC, Hancock SI. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J Clin Microbiol. 1998;36:2645–51.PubMedGoogle Scholar
- Massung RF, Slater K, Owens J, Nicholson W, Mather T, Solberg V, Nested PCR assay for detection of granulocytic ehrlichiae. J Clin Microbiol. 1998;36:1090–5.PubMedGoogle Scholar
- Kordick SK, Breitschwerdt EB, Hegarty BC, Southwick KL, Colitz CM, Hancock SI, Coinfection with multiple tick-borne pathogens in a Walker Hound kennel in North Carolina. J Clin Microbiol. 1999;37:2631–8.PubMedGoogle Scholar
- Inokuma H, Fujii K, Okuda M, Onishi T, Beaufils JP, Raoult D, Determination of the nucleotide sequences of heat shock operon groESL and the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin Diagn Lab Immunol. 2002;9:1132–6.PubMedGoogle Scholar
- Chae JS, Foley JE, Dumler JS, Madigan JE. Comparison of the nucleotide sequences of 16S rRNA, 444 Ep-ank, and groESL heat shock operon genes in naturally occurring Ehrlichia equi and human granulocytic ehrlichiosis agent isolates from northern California. J Clin Microbiol. 2000;38:1364–9.PubMedGoogle Scholar
- Harvey JW, Simpson CF, Gaskin JM. Cyclic thrombocytopenia induced by a Rickettsia-like agent in dogs. J Infect Dis. 1978;137:182–8.PubMedGoogle Scholar
- Aguirre E, Tesouro MA, Ruiz L, Amusategui I, Sainz A. Genetic characterization of Anaplasma (Ehrlichia) platys in dogs in Spain. J Vet Med B Infect Dis Vet Public Health. 2006;53:197–200. DOIPubMedGoogle Scholar
- de la Fuente J, Torina A, Naranjo V, Nicosia S, Alongi A, La Mantia F, Molecular characterization of Anaplasma platys strains from dogs in Sicily, Italy. BMC Vet Res. 2006;2:24. DOIPubMedGoogle Scholar
- Huang H, Unver A, Pérez MJ, Orellana NG, Rikihisa Y. Prevalence and molecular analysis of Anaplasma platys in dogs in Lara. Venezuela. Braz J Microbiol. 2005;36:211–6. DOIGoogle Scholar
- Arraga-Alvarado C, Palmar M, Parra O, Salas P. Fine structural characterisation of a Rickettsia-like organism in human platelets from patients with symptoms of ehrlichiosis. J Med Microbiol. 1999;48:991–7. DOIPubMedGoogle Scholar
- Arraga-Alvarado C, Montero-Ojeda M, Bernardoni A, Anderson BE, Parra O. Human ehrlichiosis: report of the 1st case in Venezuela. Invest Clin. 1996;37:35–49.PubMedGoogle Scholar
Page created: July 01, 2010
Page updated: July 01, 2010
Page reviewed: July 01, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.