Volume 15, Number 11—November 2009
Letter
Rickettsia massiliae in the Canary Islands
Table
Rickettsia massiliae PCR conditions and amplicon size, Canary Islands, 2008*
| Gene | Description (GenBank accession no.) | Primer sequence (5′ → 3′) | Amplicon size, bp | PCR annealing conditions |
|---|---|---|---|---|
| 16S rRNA | 16S ribosomal RNA (GQ144453) | F: AGAGTTTGATCCTGGCTCAG R: AACGTCATTATCTTCCTTGC | 416 | 50°C/30 s |
| ompB | Outer membrane protein (GQ144450) | F: GGGTGCTGCTACACAGCAGAA R: CCGTCACCGATATTAATTGCC | 618 | 53°C/30 s |
| dnaK | Heat-shock protein 70 (GQ144451) | F: AGCGTCAAGCAACGAAAGAT R: CAAACGTTGAAGTGCTAAAGG | 323 | 50°C/30 s |
| dnaA | Chromosomal replication initiation protein (GQ144449) | F: CCTACTAACTTTGTTAGAGATT R: TGATGATTCTGCAACCGCTC | 241 | 56°C/30 s |
| recA | RecA recombination protein (GQ144452) | F: TGCTTTTATTGATGCCGAGC R: CTTTAATGGAGCCGATTCTTC | 428 | 52°C/30 s |
| atpA | ATP synthase F1 alpha subunit (GQ144448) | F: ACATATCGAGATGAAGGCTCC R: CCGAAATACCGACATTAACG | 731 | 48°C/30 s |
*GenBank accession numbers correspond to R. massiliae sequences identified in this study. PCRs were completed by employing the Access RT-PCR system (Promega, Madison, WI, USA) with 1 ng DNA, the oligonucleotide primers, and annealing conditions and with extension for 1 min at 68ºC. F, forward; R, reverse.
Page created: December 09, 2010
Page updated: December 09, 2010
Page reviewed: December 09, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.