Volume 15, Number 7—July 2009
Dispatch
WU Polyomavirus in Patients Infected with HIV or Hepatitis C Virus, Connecticut, USA, 2007
Table 1
Primers used in PCR to detect WU polyomavirus in serum specimens, Connecticut, USA, 2007
| Primer | Name | Sequence (5′ → 3′) | Genome coordinates |
|---|---|---|---|
| 1 | WU2F* | GCGCATCAAGAGGCACAGCTACTATTTC | 1377–1400 |
| 2 | WU2R* | GCGCCTAGCCTGTGAACTCCATC | 1510–1528 |
| 3 | WUoriFnest† | CTCATTTCCCCCTTTGTCAGGATG | 5011–5034 |
| 4 | WUoriRII† | CTTTCCGCTGGACTACAAAGGGC | 317–339 |
| 5 | WUoriF† | GTAAATTTCCCCAGCAGGTC | 5075–5095 |
| 6 | WUoriR† | CGGAAACTTTAAAAGGTCACAG | 153–174 |
*Primers used by Wattier et al. (6).
†The amplicon generated with these primer spans across nt 1 of the 5,229-bp circular virus genome.
References
- Allander T, Andreasson K, Gupta S, Bjerkner A, Gordana B, Perrson MA, Identification of a third human polyomavirus. J Virol. 2007;81:4130–6. DOIPubMedGoogle Scholar
- Gaynor AM, Nissen MD, Whiley DM, MacKay IM, Lambert SB, Wu G, Identification of a novel polyomavirus from patients with acute respiratory tract infections. PLoS Pathog. 2007;3:e64. DOIPubMedGoogle Scholar
- Norja P, Ubillos I, Templeton K, Simmonds P. No evidence for an association between infections with WU and KI polyomaviruses and respiratory disease. J Clin Virol. 2007;40:307–11. DOIPubMedGoogle Scholar
- Le BM, Demertzis LM, Wu G, Tibbets RJ, Buller R, Arens MQ, Clinical and epidemiologic characterization of WU polyomavirus infection, St. Louis, Missouri. Emerg Infect Dis. 2007;13:1936–8.PubMedGoogle Scholar
- Bialasiewicz S, Whiley DM, Lambert SB, Jacob K, Bletchly C, Wang D, A newly reported human polyomavirus, KI virus, is present in the respiratory tract of Australian children. J Clin Virol. 2007;40:15–8. DOIPubMedGoogle Scholar
- Wattier RL, Vazquez MV, Weibel C, Shapiro ED, Ferguson D, Landry ML, Role of human polyomaviruses in respiratory tract disease in young children. Emerg Infect Dis. 2008;14:1766–8. DOIPubMedGoogle Scholar
- Khalili K, Gordon J, White MK. The polyomavirus, JCV and its involvement in human disease. Adv Exp Med Biol. 2006;577:274–87. DOIPubMedGoogle Scholar
- Hirsch HH. Polyomavirus BK nephropathy: a (re-)emerging complication in renal transplantation. Am J Transplant. 2002;2:25–30. DOIPubMedGoogle Scholar
- Andreoletti L, Lescieux A, Lambert B, Si-Mohamed A, Matta M, Wattre P, Semiquantitative detection of JCV-DNA in peripheral blood leukocytes from HIV-1-infected patients with or without progressive multifocal leukoencephalopathy. J Med Virol. 2002;66:1–7. DOIPubMedGoogle Scholar
- Hymes LC, Warshaw BL. Polyomavirus (BK) in pediatric renal transplants: evaluation of viremic patients with and without BK associated nephritis. Pediatr Transplant. 2006;10:920–2. DOIPubMedGoogle Scholar
- Stolt A, Sasnauskas K, Koskela P, Lehtinen M, Dillner J. Seroepidemiology of the human polyomaviruses. J Gen Virol. 2003;84:1499–504. DOIPubMedGoogle Scholar
- Costa C, Bergallo M, Astegiano S, Terlizzi ME, Sidoti F, Segoloni GP, Monitoring of BK virus replication in the first year following renal transplantation. Nephrol Dial Transplant. 2008;23:3333–6. DOIPubMedGoogle Scholar
- Sharp CP, Norja P, Anthony J, Bell JE, Simmonds P. Reactivation and mutation of newly discovered WU, KI, and Merkel cell carcinoma polyomaviruses in immunosuppressed individuals. J Infect Dis. 2009;199:398–404. DOIPubMedGoogle Scholar
- zur Hausen H. Novel human polyomaviruses–re-emergence of a well known virus family as possible human carcinogens. Int J Cancer. 2008;123:247–50. DOIPubMedGoogle Scholar
- Feng H, Shuda M, Chang Y, Moore PS. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science. 2008;319:1096–100. DOIPubMedGoogle Scholar
Page created: November 10, 2010
Page updated: November 10, 2010
Page reviewed: November 10, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.