Volume 16, Number 2—February 2010
Dispatch
Bordetella pertussis Clones Identified by Multilocus Variable-Number Tandem-Repeat Analysis
Table 1
Primers used in study of Bordetella pertussis clones Identified by multilocus variable-number tandem-repeat analysis
| Primer name | Sequence, 5′ → 3′ | Genome coordinates* | Mix | Concentration,† μM | Reference |
|---|---|---|---|---|---|
| BP-VNTR1-DF | VIC-CCTGGCGGCGGGAGACGTGGTGGTG | 2194507 | 1 | 0.13 | (10) |
| BP-VNTR1-DR | AAAATTGCGGCATGTGGGCTGACTCTGA | 2194862 | 1 | (10) | |
| BP-VNTR2-BF | VIC-CGCGCCGCCTACGACCGCTATGG | 2647550 | 2 | 0.08 | (10) |
| BP-VNTR2-BR | CCCGCGCCGAAGATCTCGCCAAAGATAT | 2647412 | 2 | (10) | |
| BP-VNTR3-BF | FAM-GCCTCGGCGAAATTGCTGAAC | 2591464 | 2 | 0.23 | (10) |
| BP-VNTR3-BR | GCGGGCGAGGAAACGCCCGAGACC | 2591350 | 2 | (10) | |
| BP-VNTR4-CF | NED-CGTGCCCTGCGCCTGGACCTG | 185211 | 2 | 0.08 | (10) |
| BP-VNTR4-BR | GCCGCTGCTCGACGCCAGGGACAA | 185000 | 2 | (10) | |
| BP-VNTR5-BF | PET-GAAGCCGGCCCACCCGAGCTCCAGGCTCTT | 1005290 | 1 | 0.06 | (10) |
| BP-VNTR5-BR | TGCCGGGTTTCGGCATCTCGATGGGATACG | 1005177 | 1 | (10) | |
| BP-VNTR6-EF | FAM-CCAACGGCGGTCTGCTGGGTGGTC | 2099525 | 1 | 0.06 | (10) |
| BP-VNTR6-FR | CGCCGCCCGCTGCGCCGCTACC | 2099315 | 1 | (10) | |
| VNTR7F2 | PET-ATCAGGAAACCCACCACCACGCCGG | 124402 | 2 | 0.08 | This study |
| VNTR7R2 | GTCACCAGCCCGCAGTACTGGCG | 124585 | 2 | This study | |
| VNTR8F2 | NED-TGGGTGTCTCCGTGATAGTGAGCACTTACAC | 444776 | 1 | 0.19 | This study |
| VNTR8R2 | CTGGCGCAAAAACAGTAAGCCCGCACG | 444981 | 1 | This study |
*Based on genome sequence position of the Tohama I strain; VNTR, variable-number tandem-repeat.
†Concentrations listed are for forward and reverse primers separately.
References
- Tan T, Trindade E, Skowronski D. Epidemiology of pertussis. Pediatr Infect Dis J. 2005;24:S10–8. DOIPubMedGoogle Scholar
- Guris D, Strebel PM, Bardenheier B, Brennan M, Tachdjian R, Finch E, Changing epidemiology of pertussis in the United States: increasing reported incidence among adolescents and adults, 1990–1996. Clin Infect Dis. 1999;28:1230–7. DOIPubMedGoogle Scholar
- Celentano LPMDM, Massari MD, Paramatti DD, Salmaso SD, Tozzi AE. EUVAC-NET Group. Resurgence of pertussis in Europe. Pediatr Infect Dis J. 2005;24:761–5. DOIPubMedGoogle Scholar
- Poynten M, McIntyre PB, Mooi FR, Heuvelman KJ, Gilbert GL. Temporal trends in circulating Bordetella pertussis strains in Australia. Epidemiol Infect. 2004;132:185–93. DOIPubMedGoogle Scholar
- Bamberger ES, Srugo I. What is new in pertussis? Eur J Pediatr. 2008;167:133–9. DOIPubMedGoogle Scholar
- Mooi FR, van Loo IH, King AJ. Adaptation of Bordetella pertussis to vaccination: a cause for its reemergence? Emerg Infect Dis. 2001;7:526–8. DOIPubMedGoogle Scholar
- Mooi FR, He Q, Guiso N. Phylogeny, evolution, and epidemiology of Bordetellae. In: Locht C, editor. Bordetella molecular microbiology. Wymondham (UK): Horizon Scientific Press; 2007. p. 17–45.
- Kodama A, Kamachi K, Horiuchi Y, Konda T, Arakawa Y. Antigenic divergence suggested by correlation between antigenic variation and pulsed-field gel electrophoresis profiles of Bordetella pertussis isolates in Japan. J Clin Microbiol. 2004;42:5453–7. DOIPubMedGoogle Scholar
- Byrne S, Slack AT. Analysis of Bordetella pertussis pertactin and pertussis toxin types from Queensland, Australia, 1999–2003. BMC Infect Dis. 2006;6:53. DOIPubMedGoogle Scholar
- Schouls LM, van der Heide HG, Vauterin L, Vauterin P, Mooi FR. Multiple-locus variable-number tandem repeat analysis of Dutch Bordetella pertussis strains reveals rapid genetic changes with clonal expansion during the late 1990s. J Bacteriol. 2004;186:5496–505. DOIPubMedGoogle Scholar
- Litt DJ, Neal SE, Fry NK. Changes in genetic diversity of the Bordetella pertussis population in the United Kingdom between 1920 and 2006 reflect vaccination coverage and emergence of a single dominant clonal type. J Clin Microbiol. 2009;47:680–8. DOIPubMedGoogle Scholar
- Chan WF, Maharjan RP, Reeves PR, Sintchenko V, Gilbert GL, Lan R. Rapid and accurate typing of Bordetella pertussis targeting genes encoding acellular vaccine antigens using real time PCR and high resolution melt analysis. J Microbiol Methods. 2009;77:326–9. DOIPubMedGoogle Scholar
- van Amersfoorth SC, Schouls LM, van der Heide HG, Advani A, Hallander HO, Bondeson K, Analysis of Bordetella pertussis populations in European countries with different vaccination policies. J Clin Microbiol. 2005;43:2837–43. DOIPubMedGoogle Scholar
Page created: December 10, 2010
Page updated: December 10, 2010
Page reviewed: December 10, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.