Volume 11, Number 8—August 2005
Research
Coxiella burnetii Genotyping
Table 1
Spacer name | ORF | Nucleotide sequence (5´–3´)* | Amplified fragment length (bp) |
---|---|---|---|
Cox2 | Hypothetical protein | Cox20766 CAACCCTGAATACCCAAGGA | 397 |
Hypothetical protein | Cox21004 GAAGCTTCTGATAGGCGGGA | ||
Cox5 | Sulfatase domain protein | Cox77554 CAGGAGCAAGCTTGAATGCG | 395 |
Entericidin, putative | Cox77808 TGGTATGACAACCCGTCATG | ||
Cox18 | Ribonuclease H | Cox283060 CGCAGACGAATTAGCCAATC | 557 |
DNA polymerase III, epsilon subunit | Cox283490 TTCGATGATCCGATGGCCTT | ||
Cox20 | Hypothetical protein | Cox365301 GATATTTATCAGCGTCAAAGCAA | 631 |
Hypothetical protein | Cox365803 TCTATTATTGCAATGCAAGTGG | ||
Cox22 | Hypothetical protein | Cox378718 GGGAATAAGAGAGTTAGCTCA | 383 |
Amino acid permease family protein | Cox378965 CGCAAATTTCGGCACAGACC | ||
Cox37 | Hypothetical protein | Cox657471 GGCTTGTCTGGTGTAACTGT | 463 |
Hypothetical protein | Cox657794 ATTCCGGGACCTTCGTTAAC | ||
Cox51 | Replicative DNA helicase, intein-containing | Cox824598 TAACGCCCGAGAGCTCAGAA | 674 |
Conserved hypothetical protein – Uridine kinase | Cox825124 GCGAGAACCGAATTGCTATC | ||
Cox56 | OmpA-like transmembrane domain protein | Cox886418 CCAAGCTCTCTGTGCCCAAT | 479 |
Conserved hypothetical protein | Cox886784 ATGCGCCAGAAACGCATAGG | ||
Cox57 | Rhodanese-like domain protein | Cox892828 TGGAAATGGAAGGCGGATTC | 617 |
Hypothetical protein | Cox893316 GGTTGGAAGGCGTAAGCCTTT | ||
Cox 61 | Dioxygenase, putative | Cox956825 GAAGATAGAGCGGCAAGGAT | 611 |
Hypothetical protein | Cox957249 GGGATTTCAACTTCCGATAGA |
*The numbers are beginning or end locations of the genes where the primers were chosen.
1Dr. Glazunova and Dr. Roux contributed equally to this work.
Page created: April 23, 2012
Page updated: April 23, 2012
Page reviewed: April 23, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.