Volume 13, Number 10—October 2007
Dispatch
Foot-and-Mouth Disease Virus Serotype A in Egypt
Table 2
Oligonucleotide primers used for RT-PCR and sequencing*
Primer name | Primer sequence (5′→3′) | Sense | Gene | Position† |
---|---|---|---|---|
A-1C562F | TACCAAATTACACACGGGAA | Forward | VP3 | 3123–3142 |
A-1C612F | TAGCGCCGGCAAAGACTTTGA | Forward | VP3 | 3173–3193 |
EUR-2B52R | GACATGTCCTCCTGCATCTGGTTGAT | Reverse | 2B | 3963–3988 |
NK72 | GAAGGGCCCAGGGTTGGACTC | Reverse | 2A/2B | 3897–3917 |
A-1D523R | CGTTTCATRCGCACRAGRA | Reverse | VP1 | 3748–3766 |
*RT-PCR, reverse transcription–PCR.
†Position on the genome of A21/Lumbwa/KEN/64 (GenBank accession no. AY593761).