Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 18, Number 1—January 2012

Research

Invasive Meningococcal Capsular Group Y Disease, England and Wales, 2007–2009

Shamez N. LadhaniComments to Author , Jay Lucidarme, Lynne S. Newbold, Stephen J. Gray, Anthony D. Carr, Jamie Findlow, Mary E. Ramsay, Edward B. Kaczmarski, and Raymond Borrow
Author affiliations: Health Protection Agency, London, UK (S.N. Ladhani, M.E. Ramsay); Health Protection Agency, Manchester, UK (J. Lucidarme, L.S. Newbold, S.J. Gray, A.D. Carr, J. Findlow, E.B. Kaczmarski, R. Borrow); University of Manchester, Manchester (R. Borrow)

Main Article

Table 1

Primers used for genotypic analysis of lpxL1 of meningococcal capsular group Y, England and Wales, 2007–2009*

PCR/sequence Primer identification no. Direction Sequence, 5′ → 3′ Reference
PCR/sequence lpxL1-F†‡§ Forward TGCAGGTCAAACAGGCGGTAGT (14)
PCR/sequence lpxL1-R†¶# Reverse TTCAT(A/G)GGTTTGCGGTATTTCTTCCA (14)
PCR lpxL1-rR4‡ Reverse TCCACTTGAAATCGCGGCTGTC NA
Sequence lpxL1-s1C# Forward GTTCGAGATGGCGGTGTAC NA
Sequence lpxL1-s2# Reverse GAATCGTTGCGTCCGAAATCCTG NA
Sequence lpxL1-rR3§ Reverse AATACAGGCTTTCGCCTGCG NA
Sequence lpxL1-Rnew§ Reverse GTCAGTAAAAATCGGGGCTGCC NA

*NA, not applicable.
†Default PCR primer.
‡Alternative PCR primer.
§Used for sequence analysis of alternative PCR products (14).
¶Degenerate base added for this study.
#Used for sequence analysis of default PCR products.

Main Article

References
  1. Tan  LK, Carlone  GM, Borrow  R. Advances in the development of vaccines against Neisseria meningitidis. N Engl J Med. 2010;362:1511–20. DOIPubMedGoogle Scholar
  2. Harrison  LH, Trotter  CL, Ramsay  ME. Global epidemiology of meningococcal disease. Vaccine. 2009;27(Suppl 2):B51–63. DOIPubMedGoogle Scholar
  3. Campbell  H, Andrews  N, Borrow  R, Trotter  C, Miller  E. Updated postlicensure surveillance of the meningococcal C conjugate vaccine in England and Wales: effectiveness, validation of serological correlates of protection, and modeling predictions of the duration of herd immunity. Clin Vaccine Immunol. 2010;17:840–7. DOIPubMedGoogle Scholar
  4. Campbell  H, Borrow  R, Salisbury  D, Miller  E. Meningococcal C conjugate vaccine: the experience in England and Wales. Vaccine. 2009;27(Suppl 2):B20–9. DOIPubMedGoogle Scholar
  5. Meningococcal Reference Unit, Gray SJ, Trotter CL, Ramsay ME, Guiver M, Fox AJ, et al. Epidemiology of meningococcal disease in England and Wales 1993/94 to 2003/04: contribution and experiences of the Meningococcal Reference Unit. J Med Microbiol. 2006;55:887–96. DOIPubMedGoogle Scholar
  6. Borrow  R. Meningococcal disease and prevention at the Hajj. Travel Med Infect Dis. 2009;7:219–25. DOIPubMedGoogle Scholar
  7. Hahné  SJ, Gray  SJ, Aguilera  J-F, Crowcroft  NS, Nichols  T, Kaczmarski  EB, W135 meningococcal disease in England and Wales associated with Hajj 2000 and 2001. Lancet. 2002;359:582–3. DOIPubMedGoogle Scholar
  8. Bidmos  FA, Neal  KR, Oldfield  NJ, Turner  DP. Ala'Aldeen DA, Bayliss CD. Persistence, replacement, and rapid clonal expansion of meningococcal carriage isolates in a 2008 university student cohort. J Clin Microbiol. 2011;49:506–12. DOIPubMedGoogle Scholar
  9. Maiden  MC, Ibarz-Pavón  AB, Urwin  R, Gray  SJ, Andrews  NJ, Clarke  SC, Impact of meningococcal serogroup C conjugate vaccines on carriage and herd immunity. J Infect Dis. 2008;197:737–43. DOIPubMedGoogle Scholar
  10. Lucidarme  J, Comanducci  M, Findlow  J, Gray  SJ, Kaczmarski  EB, Guiver  M, Characterization of fHbp, nhba (gna2132), nadA, porA, sequence type (ST), and genomic presence of IS1301 in group B meningococcal ST269 clonal complex isolates from England and Wales. J Clin Microbiol. 2009;47:3577–85. DOIPubMedGoogle Scholar
  11. Lucidarme  J, Comanducci  M, Findlow  J, Gray  SJ, Kaczmarski  EB, Guiver  M, Characterization of fHbp, nhba (gna2132), nadA, porA, and sequence type in group B meningococcal case isolates collected in England and Wales during January 2008 and potential coverage of an investigational group B meningococcal vaccine. Clin Vaccine Immunol. 2010;17:919–29. DOIPubMedGoogle Scholar
  12. Lucidarme  J, Tan  L, Exley  RM, Findlow  J, Borrow  R, Tang  CM. Characterisation of Neisseria meningitidis isolates that do not express the virulence factor and vaccine antigen, factor H binding protein. Clin Vaccine Immunol. 2011;18:1002–14. DOIPubMedGoogle Scholar
  13. Jolley  KA, Brehony  C, Maiden  MC. Molecular typing of meningococci: recommendations for target choice and nomenclature. FEMS Microbiol Rev. 2007;31:89–96. DOIPubMedGoogle Scholar
  14. Tzeng  YL, Ambrose  KD, Zughaier  S, Zhou  X, Miller  YK, Shafer  WM, Cationic antimicrobial peptide resistance in Neisseria meningitidis. J Bacteriol. 2005;187:5387–96. DOIPubMedGoogle Scholar
  15. Health Protection Agency. Meningococcal Reference Unit isolates of Neisseria meningitidis: England and Wales, by serogroup and epidemiological year, 1998/99–2008/09. 2011 [cited 2011 Nov 21]. http://www.hpa.org.uk/web/HPAweb&HPAwebStandard/HPAweb_C/1234859711901
  16. Fransen  F, Heckenberg  SG, Hamstra  HJ, Feller  M, Boog  CJ, van Putten  JP, Naturally occurring lipid A mutants in Neisseria meningitidis from patients with invasive meningococcal disease are associated with reduced coagulopathy. PLoS Pathog. 2009;5:e1000396. DOIPubMedGoogle Scholar
  17. Centers for Disease Control and Prevention. Active Bacterial Core Surveillance (ABCs) report. Emerging Infections Program Network. Neisseria meningitidis, 2009. Oct2010 File—17 Nov 2010. 2010 [cited 2011 Nov 21]. http://www.cdc.gov/abcs/reports-findings/survreports/mening09.pdf
  18. Winstead  JM, McKinsey  DS, Tasker  S, De Groote  MA, Baddour  LM. Meningococcal pneumonia: characterization and review of cases seen over the past 25 years. Clin Infect Dis. 2000;30:87–94. DOIPubMedGoogle Scholar
  19. Koppes  GM, Ellenbogen  C, Gebhart  RJ. Group Y meningococcal disease in United States Air Force recruits. Am J Med. 1977;62:661–6. DOIPubMedGoogle Scholar
  20. Wang  JL, Liu  DP, Yen  JJ, Yu  CJ, Liu  HC, Lin  CY, Clinical features and outcome of sporadic serogroup W135 disease Taiwan. BMC Infect Dis. 2006;6:7. DOIPubMedGoogle Scholar
  21. Faye  A, Mariani-Kurkdjian  P, Taha  MK, Angoulvant  F, Antonios  M, Aubertin  G, Clinical features and outcome of pediatric Neisseria meningitidis serogroup W135 infection: a report of 5 cases. Clin Infect Dis. 2004;38:1635–7. DOIPubMedGoogle Scholar
  22. Vienne  P, Ducos-Galand  M, Guiyoule  A, Pires  R, Giorgini  D, Taha  MK, The role of particular strains of Neisseria meningitidis in meningococcal arthritis, pericarditis, and pneumonia. Clin Infect Dis. 2003;37:1639–42. DOIPubMedGoogle Scholar
  23. Centers for Disease Control and Prevention. Serogroup Y meningococcal disease—Illinois, Connecticut, and selected areas, United States, 1989–1996. MMWR Morb Mortal Wkly Rep. 1996;45:1010–3.PubMedGoogle Scholar
  24. Racoosin  JA, Whitney  CG, Conover  CS, Diaz  PS. Serogroup Y meningococcal disease in Chicago, 1991–1997. JAMA. 1998;280:2094–8. DOIPubMedGoogle Scholar
  25. Le Saux  N, Bettinger  JA, Wootton  S, Halperin  SA, Vaudry  W, Scheifele  DW, Profile of serogroup Y meningococcal infections in Canada: implications for vaccine selection. Can J Infect Dis Med Microbiol. 2009;20:e130–4.PubMedGoogle Scholar
  26. Erickson  L, De  WP. Complications and sequelae of meningococcal disease in Quebec, Canada, 1990–1994. Clin Infect Dis. 1998;26:1159–64. DOIPubMedGoogle Scholar
  27. Jensen  ES, Schonheyder  HC, Lind  I, Berthelsen  L, Norgard  B, Sorensen  HT. Neisseria meningitidis phenotypic markers and septicaemia, disease progress and case-fatality rate of meningococcal disease: a 20-year population-based historical follow-up study in a Danish county. J Med Microbiol. 2003;52:173–9. DOIPubMedGoogle Scholar
  28. Rosenstein  NE, Perkins  BA, Stephens  DS, Lefkowitz  L, Cartter  ML, Danila  R, The changing epidemiology of meningococcal disease in the United States, 1992–1996. J Infect Dis. 1999;180:1894–901. DOIPubMedGoogle Scholar
  29. Pålsson-McDermott  EM, O’Neill  LA. Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology. 2004;113:153–62. DOIPubMedGoogle Scholar
  30. Fransen  F, Hamstra  HJ, Boog  CJ, van Putten  JP, van den Dobbelsteen  GP, van der Ley  P. The structure of Neisseria meningitidis lipid A determines outcome in experimental meningococcal disease. Infect Immun. 2010;78:3177–86. DOIPubMedGoogle Scholar
  31. van der Ley  P, Rodenburg  G, Fransen  F, Bogaert  D, Schipper  K, Claus  H, Naturally occurring lipid A variants among meningococcal carriage and disease isolates. In: Abstracts of the Seventeenth International Pathogenic Neisseria Conference (IPNC); Banff, Canada; 2010 Sep 11–16; Abstract OM12 [cited 2011 Nov 21]. http://neisseria.org/ipnc/history.shtml
  32. Comanducci  M, Bambini  S, Brunelli  B, Adu-Bobie  J, Aricò  B, Capecchi  B, NadA, a novel vaccine candidate of Neisseria meningitidis. J Exp Med. 2002;195:1445–54. DOIPubMedGoogle Scholar
  33. Comanducci  M, Bambini  S, Caugant  DA, Mora  M, Brunelli  B, Capecchi  B, NadA diversity and carriage in Neisseria meningitidis. Infect Immun. 2004l;72:4217–23. DOIPubMedGoogle Scholar
  34. Nägele  V, Heesemann  J, Schielke  S, Jimenez-Soto  LF, Kurzai  O, Ackermann  N. Neisseria meningitidis adhesin NadA targets β1 integrins: functional similarity to Yersinia invasin. J Biol Chem. 2011;286:20536–46. DOIPubMedGoogle Scholar

Main Article

Page created: January 19, 2012
Page updated: April 23, 2012
Page reviewed: April 23, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external