Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 22, Number 12—December 2016

Research

Whole-Genome Characterization and Strain Comparison of VT2f-Producing Escherichia coli Causing Hemolytic Uremic Syndrome

Laura GrandeComments to Author , Valeria Michelacci, Roslen Bondì, Federica Gigliucci, Eelco Franz, Mahdi Askari Badouei, Sabine Schlager, Fabio Minelli, Rosangela Tozzoli, Alfredo Caprioli, and Stefano Morabito
Author affiliations: Istituto Superiore di Sanità, Rome, Italy (L. Grande, V. Michelacci, R. Bondi, F. Gigliucci, F. Minelli, R. Tozzoli, A. Caprioli, S. Morabito); National Institute for Public Health and the Environment, Bilthoven, the Netherlands (E. Franz); Faculty of Veterinary Medicine, Garmsar Branch, Islamic Azad University, Garmsar, Iran (M. Askari Badouei); Austrian Agency for Health and Food Safety, Graz, Austria (S. Schlager)

Main Article

Table 3

PCR and restriction fragment length polymorphism analysis conditions used to verify VT2f phage structure in a comparative analysis of the virulence profile of human and zoonotic VT2f-producing Escherichia coli strains*

Analysis Primer name Sequence, 5′→3′ Position Thermal profile Amplicon size, bp Restriction enzyme (obtained fragments, bp + bp)
PCR1 φ-vtx2f_1FW caccatatcccagcaactgc 1,985–2,005 95°C for 2 min, 30× (94°C for 30 s, 53°C for 30 s, 70°C for 9 min); 72°C for 10 min
6,331
PvuI (1,773 + 4,558)

φ -vtx2f_1RV
gttggcggttccgactacaa
8,315–8,296
PCR2 φ -vtx2f_2FW gcgcatcaccacttcatctt 8,337–8,357 95°C for 2 min, 30× (94°C for 30 s, 53°C for 30 s, 70°C for 9 min), 72°C for 10 min
8,166
HindIII (1,855 + 6,311)

128–1
agattgggcgtcattcactggttg
16,502–16,479
PCR3 φ -vtx2f_3FW ggagtggatattgccgacct 16,808–16,827 95°C for 2 min, 30× (94°C for 30 s, 53°C for 30s, 70°C for 9 min), 72°C for 10 min
3,927
BgIII (1,310 + 2,617)

φ -vtx2f_3RV
gtcttcctgctgaggcgatc
20,734–20,715
PCR4 φ -vtx2f_4FW taatcgcggccgtactcaag 22,172–22,191 95°C for 2 min, 30× (94°C for 30 s, 53°C for 30 s, 70°C for 9 min), 72°C for 10 min 8,808 NcoI (5,029 + 3,779)
φ -vtx2f_4RV tgttcagctccaccttacgg 30,979–30,960

*Analysis for PCR2, primer 128–1 from (5); all other data were compiled for this study. All the long PCR described were performed with the GoTaq Long PCR Master Mix (Promega, Madison, WI, USA) according to manufacturer’s instructions. Primer positions refer to the phage sequence deposited into the EMBL database (accession no. LN997803).

Main Article

References
  1. Tozzoli  R, Scheutz  F. Diarrheagenic Escherichia coli infections in umans. In: Morabito S, editor. Pathogenic Escherichia coli: molecular and cellular microbiology. Poole (UK): Caister Academic Press; 2014. p. 1–18.
  2. Tozzoli  R, Grande  L, Michelacci  V, Ranieri  P, Maugliani  A, Caprioli  A, Shiga toxin-converting phages and the emergence of new pathogenic Escherichia coli: a world in motion. Front Cell Infect Microbiol. 2014;4:80.DOIPubMedGoogle Scholar
  3. Caprioli  A, Morabito  S, Brugère  H, Oswald  E. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res. 2005;36:289–311.DOIPubMedGoogle Scholar
  4. Dell’Omo  G, Morabito  S, Quondam  R, Agrimi  U, Ciuchini  F, Macrì  A, Feral pigeons as a source of verocytotoxin-producing Escherichia coli. Vet Rec. 1998;142:309–10.DOIPubMedGoogle Scholar
  5. Schmidt  H, Scheef  J, Morabito  S, Caprioli  A, Wieler  LH, Karch  H. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl Environ Microbiol. 2000;66:1205–8.DOIPubMedGoogle Scholar
  6. Morabito  S, Dell’Omo  G, Agrimi  U, Schmidt  H, Karch  H, Cheasty  T, Detection and characterization of Shiga toxin-producing Escherichia coli in feral pigeons. Vet Microbiol. 2001;82:275–83.DOIPubMedGoogle Scholar
  7. Nielsen  EM, Skov  MN, Madsen  JJ, Lodal  J, Jespersen  JB, Baggesen  DL. Verocytotoxin-producing Escherichia coli in wild birds and rodents in close proximity to farms. Appl Environ Microbiol. 2004;70:6944–7.DOIPubMedGoogle Scholar
  8. Farooq  S, Hussain  I, Mir  MA, Bhat  MA, Wani  SA. Isolation of atypical enteropathogenic Escherichia coli and Shiga toxin 1 and 2f-producing Escherichia coli from avian species in India. Lett Appl Microbiol. 2009;48:692–7.PubMedGoogle Scholar
  9. Kobayashi  H, Kanazaki  M, Hata  E, Kubo  M. Prevalence and characteristics of eae- and stx-positive strains of Escherichia coli from wild birds in the immediate environment of Tokyo Bay. Appl Environ Microbiol. 2009;75:292–5.DOIPubMedGoogle Scholar
  10. Askari Badouei  M, Zahraei Salehi  T, Koochakzadeh  A, Kalantari  A, Tabatabaei  S. Molecular characterization, genetic diversity and antibacterial susceptibility of Escherichia coli encoding Shiga toxin 2f in domestic pigeons. Lett Appl Microbiol. 2014;59:370–6.DOIPubMedGoogle Scholar
  11. Prager  R, Fruth  A, Siewert  U, Strutz  U, Tschäpe  H. Escherichia coli encoding Shiga toxin 2f as an emerging human pathogen. Int J Med Microbiol. 2009;299:343–53.DOIPubMedGoogle Scholar
  12. Friesema  I, van der Zwaluw  K, Schuurman  T, Kooistra-Smid  M, Franz  E, van Duynhoven  Y, Emergence of Escherichia coli encoding Shiga toxin 2f in human Shiga toxin-producing E. coli (STEC) infections in the Netherlands, January 2008 to December 2011. Euro Surveill. 2014;19:26–32.DOIPubMedGoogle Scholar
  13. Friesema  IH, Keijzer-Veen  MG, Koppejan  M, Schipper  HS, van Griethuysen  AJ, Heck  ME, Hemolytic uremic syndrome associated with Escherichia coli O8:H19 and Shiga toxin 2f gene. Emerg Infect Dis. 2015;21:168–9.DOIPubMedGoogle Scholar
  14. Cuccuru  G, Orsini  M, Pinna  A, Sbardellati  A, Soranzo  N, Travaglione  A, Orione, a web-based framework for NGS analysis in microbiology. Bioinformatics. 2014;30:1928–9.DOIPubMedGoogle Scholar
  15. Bankevich  A, Nurk  S, Antipov  D, Gurevich  AA, Dvorkin  M, Kulikov  AS, SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–77.DOIPubMedGoogle Scholar
  16. Tritt  A, Eisen  JA, Facciotti  MT, Darling  AE. An integrated pipeline for de novo assembly of microbial genomes. PLoS One. 2012;7:e42304.DOIPubMedGoogle Scholar
  17. Seemann  T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30:2068–9.DOIPubMedGoogle Scholar
  18. Paton  AW, Paton  JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol. 1998;36:598–602.PubMedGoogle Scholar
  19. Caprioli  A, Nigrelli  A, Gatti  R, Zavanella  M. Isolation of verotoxin-producing Escherichia coli from slaughtered pigs. Eur J Clin Microbiol Infect Dis. 1993;12:227–8.DOIPubMedGoogle Scholar
  20. Joensen  KG, Tetzschner  AM, Iguchi  A, Aarestrup  FM, Scheutz  F. Rapid and easy in silico serotyping of Escherichia coli isolates by use of whole-genome sequencing data. J Clin Microbiol. 2015;53:2410–26.DOIPubMedGoogle Scholar
  21. Carattoli  A, Zankari  E, García-Fernández  A, Voldby Larsen  M, Lund  O, Villa  L, In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob Agents Chemother. 2014;58:3895–903.DOIPubMedGoogle Scholar
  22. Altschul  SF, Gish  W, Miller  W, Myers  EW, Lipman  DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.DOIPubMedGoogle Scholar
  23. Lindsey  RL, Fedorka-Cray  PJ, Abley  M, Turpin  JB, Meinersmann  RJ. Evaluating the occurrence of Escherichia albertii in chicken carcass rinses by PCR, Vitek analysis, and sequencing of the rpoB gene. Appl Environ Microbiol. 2015;81:1727–34.DOIPubMedGoogle Scholar
  24. Clermont  O, Christenson  JK, Denamur  E, Gordon  DM. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep. 2013;5:58–65.DOIPubMedGoogle Scholar
  25. Wirth  T, Falush  D, Lan  R, Colles  F, Mensa  P, Wieler  LH, Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol. 2006;60:1136–51.DOIPubMedGoogle Scholar
  26. Gardner  SN, Slezak  T, Hall  BG. kSNP3.0: SNP detection and phylogenetic analysis of genomes without genome alignment or reference genome. Bioinformatics. 2015;31:2877–8.DOIPubMedGoogle Scholar
  27. Dean  P, Kenny  B. The effector repertoire of enteropathogenic E. coli: ganging up on the host cell. Curr Opin Microbiol. 2009;12:101–9.DOIPubMedGoogle Scholar
  28. Karmali  MA, Mascarenhas  M, Shen  S, Ziebell  K, Johnson  S, Reid-Smith  R, Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J Clin Microbiol. 2003;41:4930–40.DOIPubMedGoogle Scholar
  29. Imamovic  L, Tozzoli  R, Michelacci  V, Minelli  F, Marziano  ML, Caprioli  A, OI-57, a genomic island of Escherichia coli O157, is present in other seropathotypes of Shiga toxin-producing E. coli associated with severe human disease. Infect Immun. 2010;78:4697–704.DOIPubMedGoogle Scholar
  30. Brunder  W, Karch  H, Schmidt  H. Complete sequence of the large virulence plasmid pSFO157 of the sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H- strain 3072/96. Int J Med Microbiol. 2006;296:467–74.DOIPubMedGoogle Scholar
  31. Friedrich  AW, Bielaszewska  M, Zhang  WL, Pulz  M, Kuczius  T, Ammon  A, Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J Infect Dis. 2002;185:74–84.DOIPubMedGoogle Scholar
  32. Jenkins  C, Willshaw  GA, Evans  J, Cheasty  T, Chart  H, Shaw  DJ, Subtyping of virulence genes in verocytotoxin-producing Escherichia coli (VTEC) other than serogroup O157 associated with disease in the United Kingdom. J Med Microbiol. 2003;52:941–7.DOIPubMedGoogle Scholar
  33. Seto  K, Taguchi  M, Kobayashi  K, Kozaki  S. Biochemical and molecular characterization of minor serogroups of Shiga toxin-producing Escherichia coli isolated from humans in Osaka prefecture. J Vet Med Sci. 2007;69:1215–22.DOIPubMedGoogle Scholar
  34. van Duynhoven  YT, Friesema  IH, Schuurman  T, Roovers  A, van Zwet  AA, Sabbe  LJ, Prevalence, characterisation and clinical profiles of Shiga toxin-producing Escherichia coli in The Netherlands. Clin Microbiol Infect. 2008;14:437–45.DOIPubMedGoogle Scholar
  35. Buvens  G, De Rauw  K, Roisin  S, Vanfraechem  G, Denis  O, Jacobs  F, Verocytotoxin-producing Escherichia coli O128ab:H2 bacteremia in a 27-year-old male with hemolytic-uremic syndrome. J Clin Microbiol. 2013;51:1633–5.DOIPubMedGoogle Scholar
  36. Feng  PC, Jinneman  K, Scheutz  F, Monday  SR. Specificity of PCR and serological assays in the detection of Escherichia coli Shiga toxin subtypes. Appl Environ Microbiol. 2011;77:6699–702.DOIPubMedGoogle Scholar
  37. Oh  JY, Kang  MS, Hwang  HT, An  BK, Kwon  JH, Kwon  YK. Epidemiological investigation of eaeA-positive Escherichia coli and Escherichia albertii strains isolated from healthy wild birds. J Microbiol. 2011;49:747–52.DOIPubMedGoogle Scholar
  38. Ooka  T, Tokuoka  E, Furukawa  M, Nagamura  T, Ogura  Y, Arisawa  K, Human gastroenteritis outbreak associated with Escherichia albertii, Japan. Emerg Infect Dis. 2013;19:144–6.DOIPubMedGoogle Scholar
  39. Karch  H, Heesemann  J, Laufs  R, O’Brien  AD, Tacket  CO, Levine  MM. A plasmid of enterohemorrhagic Escherichia coli O157:H7 is required for expression of a new fimbrial antigen and for adhesion to epithelial cells. Infect Immun. 1987;55:455–61.PubMedGoogle Scholar
  40. Murakami  K, Etoh  Y, Ichihara  S, Maeda  E, Takenaka  S, Horikawa  K, Isolation and characteristics of Shiga toxin 2f-producing Escherichia coli among pigeons in Kyushu, Japan. PLoS One. 2014;9:e86076.DOIPubMedGoogle Scholar

Main Article

Page created: November 17, 2016
Page updated: November 17, 2016
Page reviewed: November 17, 2016
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external