Volume 22, Number 12—December 2016
Research
Whole-Genome Characterization and Strain Comparison of VT2f-Producing Escherichia coli Causing Hemolytic Uremic Syndrome
Table 3
PCR and restriction fragment length polymorphism analysis conditions used to verify VT2f phage structure in a comparative analysis of the virulence profile of human and zoonotic VT2f-producing Escherichia coli strains*
Analysis | Primer name | Sequence, 5′→3′ | Position | Thermal profile | Amplicon size, bp | Restriction enzyme (obtained fragments, bp + bp) |
---|---|---|---|---|---|---|
PCR1 | φ-vtx2f_1FW | caccatatcccagcaactgc | 1,985–2,005 | 95°C for 2 min, 30× (94°C for 30 s, 53°C for 30 s, 70°C for 9 min); 72°C for 10 min |
6,331 |
PvuI (1,773 + 4,558) |
φ -vtx2f_1RV |
gttggcggttccgactacaa |
8,315–8,296 |
||||
PCR2 | φ -vtx2f_2FW | gcgcatcaccacttcatctt | 8,337–8,357 | 95°C for 2 min, 30× (94°C for 30 s, 53°C for 30 s, 70°C for 9 min), 72°C for 10 min |
8,166 |
HindIII (1,855 + 6,311) |
128–1 |
agattgggcgtcattcactggttg |
16,502–16,479 |
||||
PCR3 | φ -vtx2f_3FW | ggagtggatattgccgacct | 16,808–16,827 | 95°C for 2 min, 30× (94°C for 30 s, 53°C for 30s, 70°C for 9 min), 72°C for 10 min |
3,927 |
BgIII (1,310 + 2,617) |
φ -vtx2f_3RV |
gtcttcctgctgaggcgatc |
20,734–20,715 |
||||
PCR4 | φ -vtx2f_4FW | taatcgcggccgtactcaag | 22,172–22,191 | 95°C for 2 min, 30× (94°C for 30 s, 53°C for 30 s, 70°C for 9 min), 72°C for 10 min | 8,808 | NcoI (5,029 + 3,779) |
φ -vtx2f_4RV | tgttcagctccaccttacgg | 30,979–30,960 |
*Analysis for PCR2, primer 128–1 from (5); all other data were compiled for this study. All the long PCR described were performed with the GoTaq Long PCR Master Mix (Promega, Madison, WI, USA) according to manufacturer’s instructions. Primer positions refer to the phage sequence deposited into the EMBL database (accession no. LN997803).
References
- Tozzoli R, Scheutz F. Diarrheagenic Escherichia coli infections in umans. In: Morabito S, editor. Pathogenic Escherichia coli: molecular and cellular microbiology. Poole (UK): Caister Academic Press; 2014. p. 1–18.
- Tozzoli R, Grande L, Michelacci V, Ranieri P, Maugliani A, Caprioli A, Shiga toxin-converting phages and the emergence of new pathogenic Escherichia coli: a world in motion. Front Cell Infect Microbiol. 2014;4:80.DOIPubMedGoogle Scholar
- Caprioli A, Morabito S, Brugère H, Oswald E. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res. 2005;36:289–311.DOIPubMedGoogle Scholar
- Dell’Omo G, Morabito S, Quondam R, Agrimi U, Ciuchini F, Macrì A, Feral pigeons as a source of verocytotoxin-producing Escherichia coli. Vet Rec. 1998;142:309–10.DOIPubMedGoogle Scholar
- Schmidt H, Scheef J, Morabito S, Caprioli A, Wieler LH, Karch H. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl Environ Microbiol. 2000;66:1205–8.DOIPubMedGoogle Scholar
- Morabito S, Dell’Omo G, Agrimi U, Schmidt H, Karch H, Cheasty T, Detection and characterization of Shiga toxin-producing Escherichia coli in feral pigeons. Vet Microbiol. 2001;82:275–83.DOIPubMedGoogle Scholar
- Nielsen EM, Skov MN, Madsen JJ, Lodal J, Jespersen JB, Baggesen DL. Verocytotoxin-producing Escherichia coli in wild birds and rodents in close proximity to farms. Appl Environ Microbiol. 2004;70:6944–7.DOIPubMedGoogle Scholar
- Farooq S, Hussain I, Mir MA, Bhat MA, Wani SA. Isolation of atypical enteropathogenic Escherichia coli and Shiga toxin 1 and 2f-producing Escherichia coli from avian species in India. Lett Appl Microbiol. 2009;48:692–7.PubMedGoogle Scholar
- Kobayashi H, Kanazaki M, Hata E, Kubo M. Prevalence and characteristics of eae- and stx-positive strains of Escherichia coli from wild birds in the immediate environment of Tokyo Bay. Appl Environ Microbiol. 2009;75:292–5.DOIPubMedGoogle Scholar
- Askari Badouei M, Zahraei Salehi T, Koochakzadeh A, Kalantari A, Tabatabaei S. Molecular characterization, genetic diversity and antibacterial susceptibility of Escherichia coli encoding Shiga toxin 2f in domestic pigeons. Lett Appl Microbiol. 2014;59:370–6.DOIPubMedGoogle Scholar
- Prager R, Fruth A, Siewert U, Strutz U, Tschäpe H. Escherichia coli encoding Shiga toxin 2f as an emerging human pathogen. Int J Med Microbiol. 2009;299:343–53.DOIPubMedGoogle Scholar
- Friesema I, van der Zwaluw K, Schuurman T, Kooistra-Smid M, Franz E, van Duynhoven Y, Emergence of Escherichia coli encoding Shiga toxin 2f in human Shiga toxin-producing E. coli (STEC) infections in the Netherlands, January 2008 to December 2011. Euro Surveill. 2014;19:26–32.DOIPubMedGoogle Scholar
- Friesema IH, Keijzer-Veen MG, Koppejan M, Schipper HS, van Griethuysen AJ, Heck ME, Hemolytic uremic syndrome associated with Escherichia coli O8:H19 and Shiga toxin 2f gene. Emerg Infect Dis. 2015;21:168–9.DOIPubMedGoogle Scholar
- Cuccuru G, Orsini M, Pinna A, Sbardellati A, Soranzo N, Travaglione A, Orione, a web-based framework for NGS analysis in microbiology. Bioinformatics. 2014;30:1928–9.DOIPubMedGoogle Scholar
- Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–77.DOIPubMedGoogle Scholar
- Tritt A, Eisen JA, Facciotti MT, Darling AE. An integrated pipeline for de novo assembly of microbial genomes. PLoS One. 2012;7:e42304.DOIPubMedGoogle Scholar
- Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30:2068–9.DOIPubMedGoogle Scholar
- Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol. 1998;36:598–602.PubMedGoogle Scholar
- Caprioli A, Nigrelli A, Gatti R, Zavanella M. Isolation of verotoxin-producing Escherichia coli from slaughtered pigs. Eur J Clin Microbiol Infect Dis. 1993;12:227–8.DOIPubMedGoogle Scholar
- Joensen KG, Tetzschner AM, Iguchi A, Aarestrup FM, Scheutz F. Rapid and easy in silico serotyping of Escherichia coli isolates by use of whole-genome sequencing data. J Clin Microbiol. 2015;53:2410–26.DOIPubMedGoogle Scholar
- Carattoli A, Zankari E, García-Fernández A, Voldby Larsen M, Lund O, Villa L, In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob Agents Chemother. 2014;58:3895–903.DOIPubMedGoogle Scholar
- Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.DOIPubMedGoogle Scholar
- Lindsey RL, Fedorka-Cray PJ, Abley M, Turpin JB, Meinersmann RJ. Evaluating the occurrence of Escherichia albertii in chicken carcass rinses by PCR, Vitek analysis, and sequencing of the rpoB gene. Appl Environ Microbiol. 2015;81:1727–34.DOIPubMedGoogle Scholar
- Clermont O, Christenson JK, Denamur E, Gordon DM. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep. 2013;5:58–65.DOIPubMedGoogle Scholar
- Wirth T, Falush D, Lan R, Colles F, Mensa P, Wieler LH, Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol. 2006;60:1136–51.DOIPubMedGoogle Scholar
- Gardner SN, Slezak T, Hall BG. kSNP3.0: SNP detection and phylogenetic analysis of genomes without genome alignment or reference genome. Bioinformatics. 2015;31:2877–8.DOIPubMedGoogle Scholar
- Dean P, Kenny B. The effector repertoire of enteropathogenic E. coli: ganging up on the host cell. Curr Opin Microbiol. 2009;12:101–9.DOIPubMedGoogle Scholar
- Karmali MA, Mascarenhas M, Shen S, Ziebell K, Johnson S, Reid-Smith R, Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J Clin Microbiol. 2003;41:4930–40.DOIPubMedGoogle Scholar
- Imamovic L, Tozzoli R, Michelacci V, Minelli F, Marziano ML, Caprioli A, OI-57, a genomic island of Escherichia coli O157, is present in other seropathotypes of Shiga toxin-producing E. coli associated with severe human disease. Infect Immun. 2010;78:4697–704.DOIPubMedGoogle Scholar
- Brunder W, Karch H, Schmidt H. Complete sequence of the large virulence plasmid pSFO157 of the sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H- strain 3072/96. Int J Med Microbiol. 2006;296:467–74.DOIPubMedGoogle Scholar
- Friedrich AW, Bielaszewska M, Zhang WL, Pulz M, Kuczius T, Ammon A, Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J Infect Dis. 2002;185:74–84.DOIPubMedGoogle Scholar
- Jenkins C, Willshaw GA, Evans J, Cheasty T, Chart H, Shaw DJ, Subtyping of virulence genes in verocytotoxin-producing Escherichia coli (VTEC) other than serogroup O157 associated with disease in the United Kingdom. J Med Microbiol. 2003;52:941–7.DOIPubMedGoogle Scholar
- Seto K, Taguchi M, Kobayashi K, Kozaki S. Biochemical and molecular characterization of minor serogroups of Shiga toxin-producing Escherichia coli isolated from humans in Osaka prefecture. J Vet Med Sci. 2007;69:1215–22.DOIPubMedGoogle Scholar
- van Duynhoven YT, Friesema IH, Schuurman T, Roovers A, van Zwet AA, Sabbe LJ, Prevalence, characterisation and clinical profiles of Shiga toxin-producing Escherichia coli in The Netherlands. Clin Microbiol Infect. 2008;14:437–45.DOIPubMedGoogle Scholar
- Buvens G, De Rauw K, Roisin S, Vanfraechem G, Denis O, Jacobs F, Verocytotoxin-producing Escherichia coli O128ab:H2 bacteremia in a 27-year-old male with hemolytic-uremic syndrome. J Clin Microbiol. 2013;51:1633–5.DOIPubMedGoogle Scholar
- Feng PC, Jinneman K, Scheutz F, Monday SR. Specificity of PCR and serological assays in the detection of Escherichia coli Shiga toxin subtypes. Appl Environ Microbiol. 2011;77:6699–702.DOIPubMedGoogle Scholar
- Oh JY, Kang MS, Hwang HT, An BK, Kwon JH, Kwon YK. Epidemiological investigation of eaeA-positive Escherichia coli and Escherichia albertii strains isolated from healthy wild birds. J Microbiol. 2011;49:747–52.DOIPubMedGoogle Scholar
- Ooka T, Tokuoka E, Furukawa M, Nagamura T, Ogura Y, Arisawa K, Human gastroenteritis outbreak associated with Escherichia albertii, Japan. Emerg Infect Dis. 2013;19:144–6.DOIPubMedGoogle Scholar
- Karch H, Heesemann J, Laufs R, O’Brien AD, Tacket CO, Levine MM. A plasmid of enterohemorrhagic Escherichia coli O157:H7 is required for expression of a new fimbrial antigen and for adhesion to epithelial cells. Infect Immun. 1987;55:455–61.PubMedGoogle Scholar
- Murakami K, Etoh Y, Ichihara S, Maeda E, Takenaka S, Horikawa K, Isolation and characteristics of Shiga toxin 2f-producing Escherichia coli among pigeons in Kyushu, Japan. PLoS One. 2014;9:e86076.DOIPubMedGoogle Scholar
Page created: November 17, 2016
Page updated: November 17, 2016
Page reviewed: November 17, 2016
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.